Quick Order

Rat MAP2 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat METAP2 cDNA Clone Product Information
    NCBI RefSeq:BC091150.1
    RefSeq ORF Size:1437bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus methionyl aminopeptidase 2 with C terminal His tag.
    Gene Synonym:p67, Amp2, Mnpep
    Species:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with METAP2 qPCR primers for gene expression analysis, RP301143 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    METAP2 (Methionine aminopeptidase 2), also known as MAP2 is a a protein which belongs to the peptidase M24A family. MAP2 binds 2 cobalt or manganese ions and contains approximately 12 O-linked N-acetylglucosamine (GlcNAc) residues. It is found in all organisms and is especially important because of its critical role in tissue repair and protein degradation. The catalytic activity of human MAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. MAP2 protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. It also plays a critical role in the regulation of protein synthesis.

    References
  • Bennett, et al. (1997) EPR Studies on the Mono- and Dicobalt (II)-Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases. J Am Chem Soc. 119:1923-33.
  • Johansson, et al. (2008) Dicobalt II-II, II-III, and III-III Complexes as Spectroscopic Models for Dicobalt Enzyme Active Sites. Inorg Chem. 47:5079-92.
  • Bradshaw, et al. (2002) Aminopeptidases and angiogenesis. Essays Biochem. 38: 5-78.
  • Size / Price
    Catalog: RG81187-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"