LYZ2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81115-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LYZ2 Reagents

CRO Services

Product recommended


All LYZ2 Reagents

LYZ2 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
447 bp
Description
Full length Clone DNA of Rat lysozyme 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYZ2 Background Information

Full Name
lysozyme 2

LYZ2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LYZ2 cDNA ORF Clone in Cloning Vector, Rat RG81115-U
LYZ2 cDNA ORF Clone, Rat, untagged RG81115-UT
LYZ2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81115-ACG
LYZ2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81115-ACGLN
LYZ2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81115-ACR
LYZ2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81115-CF
LYZ2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81115-NF
LYZ2 cDNA ORF Clone, Rat, C-His tag RG81115-CH
LYZ2 cDNA ORF Clone, Rat, N-His tag RG81115-NH
LYZ2 cDNA ORF Clone, Rat, C-HA tag RG81115-CY
LYZ2 cDNA ORF Clone, Rat, N-HA tag RG81115-NY
LYZ2 cDNA ORF Clone, Rat, N-Myc tag RG81115-NM
LYZ2 qPCR Primer Pairs, Rat RP301072

LYZ2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LYZ2 cDNA ORF Clone in Cloning Vector, Mouse MG52758-G
LYZ2 cDNA ORF Clone, Mouse, untagged MG52758-UT
LYZ2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52758-ACGLN
LYZ2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52758-ACG
LYZ2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52758-ANG
LYZ2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52758-ACR
LYZ2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52758-ANR
LYZ2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52758-CF
LYZ2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52758-NF
LYZ2 cDNA ORF Clone, Mouse, C-His tag MG52758-CH
LYZ2 cDNA ORF Clone, Mouse, N-His tag MG52758-NH
LYZ2 cDNA ORF Clone, Mouse, C-HA tag MG52758-CY
LYZ2 cDNA ORF Clone, Mouse, N-HA tag MG52758-NY
LYZ2 cDNA ORF Clone, Mouse, C-Myc tag MG52758-CM
LYZ2 cDNA ORF Clone, Mouse, N-Myc tag MG52758-NM
info info
添加购物车成功! 添加购物车失败!