LY6E cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80502-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LY6E Reagents
CRO Services
Product recommended

All LY6E Reagents
LY6E cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
411 bp
Description
Full length Clone DNA of Rat lymphocyte antigen 6 complex, locus E with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LY6E Background Information
Full Name
lymphocyte antigen 6 complex, locus E

LY6E cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LY6E cDNA ORF Clone in Cloning Vector, Rhesus CG90486-G
LY6E cDNA ORF Clone, Rhesus, untagged CG90486-UT
LY6E Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90486-ACGLN
LY6E cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90486-ACG
LY6E cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90486-ACR
LY6E cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90486-CF
LY6E cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90486-NF
LY6E cDNA ORF Clone, Rhesus, C-His tag CG90486-CH
LY6E cDNA ORF Clone, Rhesus, N-His tag CG90486-NH
LY6E cDNA ORF Clone, Rhesus, C-HA tag CG90486-CY
LY6E cDNA ORF Clone, Rhesus, N-HA tag CG90486-NY
LY6E cDNA ORF Clone, Rhesus, C-Myc tag CG90486-CM
LY6E cDNA ORF Clone, Rhesus, N-Myc tag CG90486-NM

LY6E cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LY6E cDNA ORF Clone in Cloning Vector, Rat RG80502-U
LY6E cDNA ORF Clone, Rat, untagged RG80502-UT
LY6E cDNA ORF Clone, Rat, C-GFPSpark® tag RG80502-ACG
LY6E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80502-ACGLN
LY6E cDNA ORF Clone, Rat, C-OFPSpark® tag RG80502-ACR
LY6E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80502-CF
LY6E cDNA ORF Clone, Rat, C-His tag RG80502-CH
LY6E cDNA ORF Clone, Rat, N-His tag RG80502-NH
LY6E cDNA ORF Clone, Rat, C-HA tag RG80502-CY
LY6E cDNA ORF Clone, Rat, N-HA tag RG80502-NY
LY6E cDNA ORF Clone, Rat, C-Myc tag RG80502-CM
LY6E cDNA ORF Clone, Rat, N-Myc tag RG80502-NM
LY6E qPCR Primer Pairs, Rat RP300466

LY6E cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LY6E cDNA ORF Clone in Cloning Vector, Mouse MG51901-G
LY6E cDNA ORF Clone, Mouse, untagged MG51901-UT
LY6E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51901-ACGLN
LY6E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51901-ACG
LY6E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51901-ACR
LY6E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51901-CF
LY6E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51901-NF
LY6E cDNA ORF Clone, Mouse, C-His tag MG51901-CH
LY6E cDNA ORF Clone, Mouse, N-His tag MG51901-NH
LY6E cDNA ORF Clone, Mouse, C-HA tag MG51901-CY
LY6E cDNA ORF Clone, Mouse, N-HA tag MG51901-NY
LY6E cDNA ORF Clone, Mouse, C-Myc tag MG51901-CM
LY6E cDNA ORF Clone, Mouse, N-Myc tag MG51901-NM
LY6E qPCR Primer Pairs, Mouse MP201774

LY6E cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LY6E cDNA ORF Clone in Cloning Vector, Human HG16471-G
LY6E cDNA ORF Clone, Human, untagged HG16471-UT
LY6E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16471-ACGLN
LY6E cDNA ORF Clone, Human, C-GFPSpark® tag HG16471-ACG
LY6E cDNA ORF Clone, Human, C-OFPSpark® tag HG16471-ACR
LY6E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16471-CF
LY6E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16471-NF
LY6E cDNA ORF Clone, Human, C-His tag HG16471-CH
LY6E cDNA ORF Clone, Human, N-His tag HG16471-NH
LY6E cDNA ORF Clone, Human, C-HA tag HG16471-CY
LY6E cDNA ORF Clone, Human, N-HA tag HG16471-NY
LY6E cDNA ORF Clone, Human, C-Myc tag HG16471-CM
LY6E cDNA ORF Clone, Human, N-Myc tag HG16471-NM
LY6E qPCR Primer Pairs, Human HP105216
info info
添加购物车成功! 添加购物车失败!