Text Size:AAA

Rat TNF-beta/TNFSF1/Lymphotoxin alpha Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Rat LTA cDNA Clone Product Information
    NCBI RefSeq:NM_080769.2
    RefSeq ORF Size:609bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus lymphotoxin alpha (TNF superfamily, member 1) with N terminal HA tag.
    Gene Synonym:Tnfb, Tnfsf1, Lta
    Species:Rat
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LTA qPCR primers for gene expression analysis, RP300142 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

    References
  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • Size / Price
    Catalog: RG80147-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"