LRRC57 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80974-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LRRC57 Reagents
CRO Services
Product recommended

All LRRC57 Reagents
LRRC57 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
720 bp
Description
Full length Clone DNA of Rat leucine rich repeat containing 57 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRRC57 cDNA ORF Clone, Rat, N-Myc tag Alternative Names
RGD1307128 cDNA ORF Clone, Rat
LRRC57 Background Information
Full Name
leucine rich repeat containing 57

LRRC57 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LRRC57 cDNA ORF Clone in Cloning Vector, Rat RG80974-U
LRRC57 cDNA ORF Clone, Rat, untagged RG80974-UT
LRRC57 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80974-ACGLN
LRRC57 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80974-ACG
LRRC57 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80974-ANG
LRRC57 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80974-ACR
LRRC57 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80974-ANR
LRRC57 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80974-CF
LRRC57 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80974-NF
LRRC57 cDNA ORF Clone, Rat, C-His tag RG80974-CH
LRRC57 cDNA ORF Clone, Rat, N-His tag RG80974-NH
LRRC57 cDNA ORF Clone, Rat, C-HA tag RG80974-CY
LRRC57 cDNA ORF Clone, Rat, N-HA tag RG80974-NY
LRRC57 cDNA ORF Clone, Rat, C-Myc tag RG80974-CM
LRRC57 qPCR Primer Pairs, Rat RP300938

LRRC57 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LRRC57 cDNA ORF Clone in Cloning Vector, Mouse MG52666-G
LRRC57 cDNA ORF Clone, Mouse, untagged MG52666-UT
LRRC57 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52666-ACG
LRRC57 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52666-ACGLN
LRRC57 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52666-ANG
LRRC57 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52666-ACR
LRRC57 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52666-ANR
LRRC57 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52666-CF
LRRC57 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52666-NF
LRRC57 cDNA ORF Clone, Mouse, C-His tag MG52666-CH
LRRC57 cDNA ORF Clone, Mouse, N-His tag MG52666-NH
LRRC57 cDNA ORF Clone, Mouse, C-HA tag MG52666-CY
LRRC57 cDNA ORF Clone, Mouse, N-HA tag MG52666-NY
LRRC57 cDNA ORF Clone, Mouse, C-Myc tag MG52666-CM
LRRC57 cDNA ORF Clone, Mouse, N-Myc tag MG52666-NM
LRRC57 qPCR Primer Pairs, Mouse MP202537

LRRC57 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LRRC57 cDNA ORF Clone in Cloning Vector, Human HG26602-U
LRRC57 cDNA ORF Clone, Human, untagged HG26602-UT
LRRC57 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26602-ACGLN
LRRC57 cDNA ORF Clone, Human, C-GFPSpark® tag HG26602-ACG
LRRC57 cDNA ORF Clone, Human, N-GFPSpark® tag HG26602-ANG
LRRC57 cDNA ORF Clone, Human, C-OFPSpark® tag HG26602-ACR
LRRC57 cDNA ORF Clone, Human, N-OFPSpark® tag HG26602-ANR
LRRC57 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26602-CF
LRRC57 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26602-NF
LRRC57 cDNA ORF Clone, Human, C-His tag HG26602-CH
LRRC57 cDNA ORF Clone, Human, N-His tag HG26602-NH
LRRC57 cDNA ORF Clone, Human, C-HA tag HG26602-CY
LRRC57 cDNA ORF Clone, Human, N-HA tag HG26602-NY
LRRC57 cDNA ORF Clone, Human, C-Myc tag HG26602-CM
LRRC57 cDNA ORF Clone, Human, N-Myc tag HG26602-NM
info info
添加购物车成功! 添加购物车失败!