LRRC28 cDNA ORF Clone, Rat, C-His tag

Cat: RG81081-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LRRC28 Reagents
CRO Services
Product recommended

All LRRC28 Reagents
LRRC28 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1104 bp
Description
Full length Clone DNA of Rat leucine rich repeat containing 28 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRRC28 Background Information
Full Name
leucine rich repeat containing 28

LRRC28 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LRRC28 cDNA ORF Clone in Cloning Vector, Rhesus CG90334-G
LRRC28 cDNA ORF Clone, Rhesus, untagged CG90334-UT
LRRC28 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90334-ACG
LRRC28 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90334-ACGLN
LRRC28 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90334-ANG
LRRC28 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90334-ACR
LRRC28 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90334-ANR
LRRC28 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90334-CF
LRRC28 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90334-NF
LRRC28 cDNA ORF Clone, Rhesus, C-His tag CG90334-CH
LRRC28 cDNA ORF Clone, Rhesus, N-His tag CG90334-NH
LRRC28 cDNA ORF Clone, Rhesus, C-HA tag CG90334-CY
LRRC28 cDNA ORF Clone, Rhesus, N-HA tag CG90334-NY
LRRC28 cDNA ORF Clone, Rhesus, C-Myc tag CG90334-CM
LRRC28 cDNA ORF Clone, Rhesus, N-Myc tag CG90334-NM

LRRC28 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LRRC28 cDNA ORF Clone in Cloning Vector, Rat RG81081-U
LRRC28 cDNA ORF Clone, Rat, untagged RG81081-UT
LRRC28 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81081-ACGLN
LRRC28 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81081-ACG
LRRC28 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81081-ANG
LRRC28 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81081-ACR
LRRC28 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81081-ANR
LRRC28 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81081-CF
LRRC28 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81081-NF
LRRC28 cDNA ORF Clone, Rat, N-His tag RG81081-NH
LRRC28 cDNA ORF Clone, Rat, C-HA tag RG81081-CY
LRRC28 cDNA ORF Clone, Rat, N-HA tag RG81081-NY
LRRC28 cDNA ORF Clone, Rat, C-Myc tag RG81081-CM
LRRC28 cDNA ORF Clone, Rat, N-Myc tag RG81081-NM
LRRC28 qPCR Primer Pairs, Rat RP301038

LRRC28 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LRRC28 cDNA ORF Clone in Cloning Vector, Mouse MG55510-U
LRRC28 cDNA ORF Clone, Mouse, untagged MG55510-UT
LRRC28 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55510-ACGLN
LRRC28 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55510-ACG
LRRC28 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55510-ANG
LRRC28 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55510-ACR
LRRC28 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55510-ANR
LRRC28 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55510-CF
LRRC28 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55510-NF
LRRC28 cDNA ORF Clone, Mouse, C-His tag MG55510-CH
LRRC28 cDNA ORF Clone, Mouse, N-His tag MG55510-NH
LRRC28 cDNA ORF Clone, Mouse, C-HA tag MG55510-CY
LRRC28 cDNA ORF Clone, Mouse, N-HA tag MG55510-NY
LRRC28 cDNA ORF Clone, Mouse, C-Myc tag MG55510-CM
LRRC28 cDNA ORF Clone, Mouse, N-Myc tag MG55510-NM

LRRC28 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LRRC28 cDNA ORF Clone in Cloning Vector, Human HG27122-U
LRRC28 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27122-ACGLN
info info
添加购物车成功! 添加购物车失败!