SF3B6 cDNA ORF Clone, Rat, C-His tag

Cat: RG80556-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SF3B6 Reagents
CRO Services
Product recommended

All SF3B6 Reagents
SF3B6 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
378 bp
Description
Full length Clone DNA of Rat splicing factor 3B, 14 kDa subunit-like with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SF3B6 Background Information
Full Name
splicing factor 3b subunit 6

SF3B6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SF3B6 cDNA ORF Clone in Cloning Vector, Rat RG80556-U
SF3B6 cDNA ORF Clone, Rat, untagged RG80556-UT
SF3B6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80556-ACG
SF3B6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80556-ACGLN
SF3B6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80556-ANG
SF3B6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80556-ACR
SF3B6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80556-ANR
SF3B6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80556-CF
SF3B6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80556-NF
SF3B6 cDNA ORF Clone, Rat, N-His tag RG80556-NH
SF3B6 cDNA ORF Clone, Rat, C-HA tag RG80556-CY
SF3B6 cDNA ORF Clone, Rat, N-HA tag RG80556-NY
SF3B6 cDNA ORF Clone, Rat, C-Myc tag RG80556-CM
SF3B6 cDNA ORF Clone, Rat, N-Myc tag RG80556-NM

SF3B6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SF3B6 cDNA ORF Clone in Cloning Vector, Mouse MG53465-U
SF3B6 cDNA ORF Clone, Mouse, untagged MG53465-UT
SF3B6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53465-ACGLN
SF3B6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53465-ACG
SF3B6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53465-ANG
SF3B6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53465-ACR
SF3B6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53465-ANR
SF3B6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53465-CF
SF3B6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53465-NF
SF3B6 cDNA ORF Clone, Mouse, C-His tag MG53465-CH
SF3B6 cDNA ORF Clone, Mouse, N-His tag MG53465-NH
SF3B6 cDNA ORF Clone, Mouse, C-HA tag MG53465-CY
SF3B6 cDNA ORF Clone, Mouse, N-HA tag MG53465-NY
SF3B6 cDNA ORF Clone, Mouse, C-Myc tag MG53465-CM
SF3B6 cDNA ORF Clone, Mouse, N-Myc tag MG53465-NM

SF3B6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SF3B6 cDNA ORF Clone in Cloning Vector, Human HG21794-U
SF3B6 cDNA ORF Clone, Human, untagged HG21794-UT
SF3B6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21794-ACGLN
SF3B6 cDNA ORF Clone, Human, C-GFPSpark® tag HG21794-ACG
SF3B6 cDNA ORF Clone, Human, N-GFPSpark® tag HG21794-ANG
SF3B6 cDNA ORF Clone, Human, C-OFPSpark® tag HG21794-ACR
SF3B6 cDNA ORF Clone, Human, N-OFPSpark® tag HG21794-ANR
SF3B6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21794-CF
SF3B6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21794-NF
SF3B6 cDNA ORF Clone, Human, C-His tag HG21794-CH
SF3B6 cDNA ORF Clone, Human, N-His tag HG21794-NH
SF3B6 cDNA ORF Clone, Human, C-HA tag HG21794-CY
SF3B6 cDNA ORF Clone, Human, N-HA tag HG21794-NY
SF3B6 cDNA ORF Clone, Human, C-Myc tag HG21794-CM
SF3B6 cDNA ORF Clone, Human, N-Myc tag HG21794-NM
info info
添加购物车成功! 添加购物车失败!