Quick Order

Rat LMAN2 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat LMAN2 cDNA Clone Product Information
NCBI RefSeq:NM_001115024.2
RefSeq ORF Size:1077bp
cDNA Description:Full length Clone DNA of Rattus norvegicus lectin, mannose-binding 2 with N terminal Myc tag.
Gene Synonym:Vip36
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LMAN2 qPCR primers for gene expression analysis, RP300986 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
References
  • Nawa D, et al. (2007) Stable interaction of the cargo receptor VIP36 with molecular chaperone BiP. Glycobiology. 17(9): 913-21.
  • Shimada O, et al. (2003) Localization of VIP36 in the post-Golgi secretory pathway also of rat parotid acinar cells. J Histochem Cytochem. 51(8): 1057-63.
  • Hara-Kuge S, et al. (1999) Vesicular-integral membrane protein, VIP36, recognizes high-mannose type glycans containing alpha1--2 mannosyl residues in MDCK cells. Glycobiology. 9(8): 833-9.
  • Fullekrug J, et al. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci. 112 ( Pt 17): 2813-21.
  • Size / Price
    Catalog: RG81022-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"