LILRA5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80334-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LILRA5 Reagents
CRO Services
Product recommended

All LILRA5 Reagents
LILRA5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Rat leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LILRA5 Background Information

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

Full Name
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
References
  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • LILRA5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LILRA5 cDNA ORF Clone in Cloning Vector, Rat RG80334-G
    LILRA5 cDNA ORF Clone, Rat, untagged RG80334-UT
    LILRA5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80334-ACG
    LILRA5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80334-ACGLN
    LILRA5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80334-ACR
    LILRA5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80334-CF
    LILRA5 cDNA ORF Clone, Rat, C-His tag RG80334-CH
    LILRA5 cDNA ORF Clone, Rat, N-His tag RG80334-NH
    LILRA5 cDNA ORF Clone, Rat, C-HA tag RG80334-CY
    LILRA5 cDNA ORF Clone, Rat, N-HA tag RG80334-NY
    LILRA5 cDNA ORF Clone, Rat, C-Myc tag RG80334-CM
    LILRA5 cDNA ORF Clone, Rat, N-Myc tag RG80334-NM
    LILRA5 qPCR Primer Pairs, Rat RP300304

    LILRA5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LILRA5 cDNA ORF Clone in Cloning Vector, Mouse MG50762-G
    LILRA5 cDNA ORF Clone, Mouse, untagged MG50762-UT
    LILRA5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50762-ACGLN
    LILRA5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50762-ACG
    LILRA5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50762-ACR
    LILRA5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50762-CF
    LILRA5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50762-NF
    LILRA5 cDNA ORF Clone, Mouse, C-His tag MG50762-CH
    LILRA5 cDNA ORF Clone, Mouse, N-His tag MG50762-NH
    LILRA5 cDNA ORF Clone, Mouse, C-HA tag MG50762-CY
    LILRA5 cDNA ORF Clone, Mouse, N-HA tag MG50762-NY
    LILRA5 cDNA ORF Clone, Mouse, C-Myc tag MG50762-CM
    LILRA5 cDNA ORF Clone, Mouse, N-Myc tag MG50762-NM
    LILRA5 qPCR Primer Pairs, Mouse MP200736

    LILRA5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LILRA5 cDNA ORF Clone in Cloning Vector, Human HG16059-G
    LILRA5 cDNA ORF Clone, Human, untagged HG16059-UT
    LILRA5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16059-ACG
    LILRA5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16059-ACGLN
    LILRA5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16059-ACR
    LILRA5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16059-CF
    LILRA5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16059-NF
    LILRA5 cDNA ORF Clone, Human, C-His tag HG16059-CH
    LILRA5 cDNA ORF Clone, Human, N-His tag HG16059-NH
    LILRA5 cDNA ORF Clone, Human, C-HA tag HG16059-CY
    LILRA5 cDNA ORF Clone, Human, N-HA tag HG16059-NY
    LILRA5 cDNA ORF Clone, Human, C-Myc tag HG16059-CM
    LILRA5 cDNA ORF Clone, Human, N-Myc tag HG16059-NM
    info info
    添加购物车成功! 添加购物车失败!