Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80253-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Galectin-4/LGALS4 Reagents
CRO Services
Product recommended

All Galectin-4/LGALS4 Reagents
Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
975 bp
Description
Full length Clone DNA of Rat lectin, galactoside-binding, soluble, 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-4/LGALS4 Background Information
Full Name
lectin, galactoside-binding, soluble, 4

Galectin-4/LGALS4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Galectin-4/LGALS4 cDNA ORF Clone in Cloning Vector, Rat RG80253-G
Galectin-4/LGALS4 cDNA ORF Clone, Rat, untagged RG80253-UT
Galectin-4/LGALS4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80253-ACG
Galectin-4/LGALS4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80253-ACGLN
Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80253-ANG
Galectin-4/LGALS4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80253-ACR
Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80253-ANR
Galectin-4/LGALS4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80253-CF
Galectin-4/LGALS4 cDNA ORF Clone, Rat, C-His tag RG80253-CH
Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-His tag RG80253-NH
Galectin-4/LGALS4 cDNA ORF Clone, Rat, C-HA tag RG80253-CY
Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-HA tag RG80253-NY
Galectin-4/LGALS4 cDNA ORF Clone, Rat, C-Myc tag RG80253-CM
Galectin-4/LGALS4 cDNA ORF Clone, Rat, N-Myc tag RG80253-NM
Galectin-4/LGALS4 qPCR Primer Pairs, Rat RP300238

Galectin-4/LGALS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Galectin-4/LGALS4 cDNA ORF Clone in Cloning Vector, Mouse MG50426-M
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, untagged MG50426-UT
Galectin-4/LGALS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50426-ACGLN
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50426-ACG
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50426-ANG
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50426-ACR
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50426-ANR
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50426-CF
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50426-NF
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, C-His tag MG50426-CH
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, N-His tag MG50426-NH
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, C-HA tag MG50426-CY
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, N-HA tag MG50426-NY
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, C-Myc tag MG50426-CM
Galectin-4/LGALS4 cDNA ORF Clone, Mouse, N-Myc tag MG50426-NM
Galectin-4/LGALS4 qPCR Primer Pairs, Mouse MP200436

Galectin-4/LGALS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Galectin-4/LGALS4 cDNA ORF Clone in Cloning Vector, Human HG10291-M
Galectin-4/LGALS4 cDNA ORF Clone, Human, untagged HG10291-UT
Galectin-4/LGALS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10291-ACG
Galectin-4/LGALS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10291-ACGLN
Galectin-4/LGALS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10291-ANG
Galectin-4/LGALS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10291-ACR
Galectin-4/LGALS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10291-ANR
Galectin-4/LGALS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10291-CF
Galectin-4/LGALS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10291-NF
Galectin-4/LGALS4 cDNA ORF Clone, Human, C-His tag HG10291-CH
Galectin-4/LGALS4 cDNA ORF Clone, Human, N-His tag HG10291-NH
Galectin-4/LGALS4 cDNA ORF Clone, Human, C-HA tag HG10291-CY
Galectin-4/LGALS4 cDNA ORF Clone, Human, N-HA tag HG10291-NY
Galectin-4/LGALS4 cDNA ORF Clone, Human, C-Myc tag HG10291-CM
Galectin-4/LGALS4 cDNA ORF Clone, Human, N-Myc tag HG10291-NM
Galectin-4/LGALS4 qPCR Primer Pairs, Human HP100336
info info
添加购物车成功! 添加购物车失败!