Lefty2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80129-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Lefty2 Reagents
CRO Services
Product recommended

All Lefty2 Reagents
Lefty2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1101 bp
Description
Full length Clone DNA of Rat Left-right determination factor 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lefty2 Background Information

left-right determination factor 2 (Lefty2), also known as Left-right determination factor A (Lefty A), endometrial bleeding associated factor (left-right determination, factor A transforming growth factor beta superfamily), and Transforming growth factor beta-4, is a member of the TGF-beta family of proteins. This protein is secreted and plays a role in left-right asymmetry determination of organ systems during development. Lefty2/Lefty A may also play a role in endometrial bleeding. Mutations in Lefty2/Lefty A have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. Alternative processing of this protein can yield three different products. Depletion of both Lefty1 and Lefty2 causes unchecked Nodal signaling, expansion of mesendoderm, and loss of ectoderm. The expansion of mesendoderm correlates with an extended period of rapid cellular internalization and a failure of deep-cell epiboly. The gastrulation defects of embryos depleted of Lefty1 and Lefty2 result from the deregulation of Squint signaling.

Full Name
left-right determination factor 2
References
  • Feldman B, et al. (2002) Lefty antagonism of Squint is essential for normal gastrulation. Curr Biol. 12(24): 2129-35.
  • Meno C, et al. (1999) Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 4(3): 287-98.
  • Meno C, et al. (2001) Diffusion of nodal signaling activity in the absence of the feedback inhibitor Lefty2. Dev Cell. 1(1): 127-38.
  • info info
    添加购物车成功! 添加购物车失败!