LAPTM5 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80933-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LAPTM5 Reagents
CRO Services
Product recommended

All LAPTM5 Reagents
LAPTM5 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Rat lysosomal protein transmembrane 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAPTM5 Background Information
Full Name
lysosomal protein transmembrane 5

LAPTM5 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
LAPTM5 cDNA ORF Clone in Cloning Vector, Rabbit TG65131-G
LAPTM5 cDNA ORF Clone, Rabbit, untagged TG65131-UT
LAPTM5 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65131-ACG
LAPTM5 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65131-ACGLN
LAPTM5 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65131-ANG
LAPTM5 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65131-ACR
LAPTM5 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65131-ANR
LAPTM5 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65131-CF
LAPTM5 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65131-NF
LAPTM5 cDNA ORF Clone, Rabbit, C-His tag TG65131-CH
LAPTM5 cDNA ORF Clone, Rabbit, N-His tag TG65131-NH
LAPTM5 cDNA ORF Clone, Rabbit, C-HA tag TG65131-CY
LAPTM5 cDNA ORF Clone, Rabbit, N-HA tag TG65131-NY
LAPTM5 cDNA ORF Clone, Rabbit, C-Myc tag TG65131-CM
LAPTM5 cDNA ORF Clone, Rabbit, N-Myc tag TG65131-NM

LAPTM5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LAPTM5 cDNA ORF Clone in Cloning Vector, Rat RG80933-U
LAPTM5 cDNA ORF Clone, Rat, untagged RG80933-UT
LAPTM5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80933-ACGLN
LAPTM5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80933-ACG
LAPTM5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80933-ANG
LAPTM5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80933-ACR
LAPTM5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80933-ANR
LAPTM5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80933-CF
LAPTM5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80933-NF
LAPTM5 cDNA ORF Clone, Rat, C-His tag RG80933-CH
LAPTM5 cDNA ORF Clone, Rat, N-His tag RG80933-NH
LAPTM5 cDNA ORF Clone, Rat, C-HA tag RG80933-CY
LAPTM5 cDNA ORF Clone, Rat, N-HA tag RG80933-NY
LAPTM5 cDNA ORF Clone, Rat, C-Myc tag RG80933-CM
LAPTM5 qPCR Primer Pairs, Rat RP300897

LAPTM5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LAPTM5 cDNA ORF Clone in Cloning Vector, Human HG20758-U
info info
添加购物车成功! 添加购物车失败!