LAMTOR1 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80630-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LAMTOR1 Reagents
CRO Services
Product recommended

All LAMTOR1 Reagents
LAMTOR1 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Rat late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAMTOR1 Background Information
Full Name
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

LAMTOR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LAMTOR1 cDNA ORF Clone in Cloning Vector, Rat RG80630-U
LAMTOR1 cDNA ORF Clone, Rat, untagged RG80630-UT
LAMTOR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80630-ACG
LAMTOR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80630-ACGLN
LAMTOR1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80630-ANG
LAMTOR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80630-ACR
LAMTOR1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80630-ANR
LAMTOR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80630-CF
LAMTOR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80630-NF
LAMTOR1 cDNA ORF Clone, Rat, C-His tag RG80630-CH
LAMTOR1 cDNA ORF Clone, Rat, N-His tag RG80630-NH
LAMTOR1 cDNA ORF Clone, Rat, N-HA tag RG80630-NY
LAMTOR1 cDNA ORF Clone, Rat, C-Myc tag RG80630-CM
LAMTOR1 cDNA ORF Clone, Rat, N-Myc tag RG80630-NM
LAMTOR1 qPCR Primer Pairs, Rat RP300594

LAMTOR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LAMTOR1 cDNA ORF Clone in Cloning Vector, Mouse MG52766-G
LAMTOR1 cDNA ORF Clone, Mouse, untagged MG52766-UT
LAMTOR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52766-ACG
LAMTOR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52766-ACGLN
LAMTOR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52766-ANG
LAMTOR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52766-ACR
LAMTOR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52766-ANR
LAMTOR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52766-CF
LAMTOR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52766-NF
LAMTOR1 cDNA ORF Clone, Mouse, C-His tag MG52766-CH
LAMTOR1 cDNA ORF Clone, Mouse, N-His tag MG52766-NH
LAMTOR1 cDNA ORF Clone, Mouse, C-HA tag MG52766-CY
LAMTOR1 cDNA ORF Clone, Mouse, N-HA tag MG52766-NY
LAMTOR1 cDNA ORF Clone, Mouse, C-Myc tag MG52766-CM
LAMTOR1 cDNA ORF Clone, Mouse, N-Myc tag MG52766-NM

LAMTOR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LAMTOR1 cDNA ORF Clone in Cloning Vector, Human HG16632-U
LAMTOR1 cDNA ORF Clone, Human, untagged HG16632-UT
LAMTOR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16632-ACG
LAMTOR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16632-ACGLN
LAMTOR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16632-ANG
LAMTOR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16632-ACR
LAMTOR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16632-ANR
LAMTOR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16632-CF
LAMTOR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16632-NF
LAMTOR1 cDNA ORF Clone, Human, C-His tag HG16632-CH
LAMTOR1 cDNA ORF Clone, Human, N-His tag HG16632-NH
LAMTOR1 cDNA ORF Clone, Human, C-HA tag HG16632-CY
LAMTOR1 cDNA ORF Clone, Human, N-HA tag HG16632-NY
LAMTOR1 cDNA ORF Clone, Human, C-Myc tag HG16632-CM
LAMTOR1 cDNA ORF Clone, Human, N-Myc tag HG16632-NM
info info
添加购物车成功! 添加购物车失败!