LAMP2 cDNA ORF Clone, Rat, untagged

Cat: RG80368-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LAMP2 Reagents
CRO Services
Product recommended

All LAMP2 Reagents
LAMP2 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Description
Full length Clone DNA of Rat lysosomal-associated membrane protein 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAMP2 Background Information

LAMP2 (Lysosomal-associated membrane protein 2), also known as CD107b (Cluster of Differentiation 107b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.

Full Name
lysosomal-associated membrane protein 2
References
  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
  • LAMP2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    LAMP2 cDNA ORF Clone in Cloning Vector, Rhesus CG90208-G
    LAMP2 cDNA ORF Clone, Rhesus, untagged CG90208-UT
    LAMP2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90208-ACG
    LAMP2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90208-ACGLN
    LAMP2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90208-ACR
    LAMP2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90208-CF
    LAMP2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90208-NF
    LAMP2 cDNA ORF Clone, Rhesus, C-His tag CG90208-CH
    LAMP2 cDNA ORF Clone, Rhesus, N-His tag CG90208-NH
    LAMP2 cDNA ORF Clone, Rhesus, C-HA tag CG90208-CY
    LAMP2 cDNA ORF Clone, Rhesus, N-HA tag CG90208-NY
    LAMP2 cDNA ORF Clone, Rhesus, C-Myc tag CG90208-CM
    LAMP2 cDNA ORF Clone, Rhesus, N-Myc tag CG90208-NM

    LAMP2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LAMP2 cDNA ORF Clone in Cloning Vector, Rat RG80368-G
    LAMP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80368-ACGLN
    LAMP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80368-ACG
    LAMP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80368-ACR
    LAMP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80368-CF
    LAMP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80368-NF
    LAMP2 cDNA ORF Clone, Rat, C-His tag RG80368-CH
    LAMP2 cDNA ORF Clone, Rat, N-His tag RG80368-NH
    LAMP2 cDNA ORF Clone, Rat, C-HA tag RG80368-CY
    LAMP2 cDNA ORF Clone, Rat, N-HA tag RG80368-NY
    LAMP2 cDNA ORF Clone, Rat, C-Myc tag RG80368-CM
    LAMP2 cDNA ORF Clone, Rat, N-Myc tag RG80368-NM
    LAMP2 qPCR Primer Pairs, Rat RP300393

    LAMP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LAMP2 cDNA ORF Clone in Cloning Vector, Mouse MG50791-G
    LAMP2 cDNA ORF Clone, Mouse, untagged MG50791-UT
    LAMP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50791-ACGLN
    LAMP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50791-ACG
    LAMP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50791-ACR
    LAMP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50791-CF
    LAMP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50791-NF
    LAMP2 cDNA ORF Clone, Mouse, C-His tag MG50791-CH
    LAMP2 cDNA ORF Clone, Mouse, N-His tag MG50791-NH
    LAMP2 cDNA ORF Clone, Mouse, C-HA tag MG50791-CY
    LAMP2 cDNA ORF Clone, Mouse, N-HA tag MG50791-NY
    LAMP2 cDNA ORF Clone, Mouse, C-Myc tag MG50791-CM
    LAMP2 cDNA ORF Clone, Mouse, N-Myc tag MG50791-NM
    LAMP2 qPCR Primer Pairs, Mouse MP200764

    LAMP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LAMP2 cDNA ORF Clone in Cloning Vector, Human HG13555-G
    LAMP2 cDNA ORF Clone, Human, untagged HG13555-UT
    LAMP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13555-ACGLN
    LAMP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13555-ACG
    LAMP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13555-ACR
    LAMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13555-CF
    LAMP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13555-NF
    LAMP2 cDNA ORF Clone, Human, C-His tag HG13555-CH
    LAMP2 cDNA ORF Clone, Human, N-His tag HG13555-NH
    LAMP2 cDNA ORF Clone, Human, C-HA tag HG13555-CY
    LAMP2 cDNA ORF Clone, Human, N-HA tag HG13555-NY
    LAMP2 cDNA ORF Clone, Human, C-Myc tag HG13555-CM
    LAMP2 cDNA ORF Clone, Human, N-Myc tag HG13555-NM
    LAMP2 qPCR Primer Pairs, Human HP102241
    info info
    添加购物车成功! 添加购物车失败!