LAMP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80226-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LAMP1 Reagents
CRO Services
Product recommended

All LAMP1 Reagents
LAMP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Rat lysosomal-associated membrane protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAMP1 Background Information

Lysosome-associated membrane glycoprotein 1, also known as CD107 antigen-like family member A, CD107a, and LAMP1, is a single-pass type I membrane protein which belongs to the LAMP family. CD107a is expressed largely in the endosome-lysosome membranes of cells, but is also found on the plasma membrane (1-2% of total LAMP1). LAMP1 has been implicated in a variety of cellular functions, including cancer metastasis. It has been proposed LAMP1 serves as a therapeutic agent for some cancers, as well as a marker for lysosomal storage disorders and different cell types such as cytotoxic T cells. LAMP2, also known as CD107b, may also play a role in tumor cell metastasis and functions in the protection, maintenance, and adhesion of the lysosome. Cell surface LAMP1 and LAMP2 have been shown to promote adhesion of human peripheral blood mononuclear cells (PBMC) to vascular endothelium, therefore they are possibly involved in the adhesion of PBMCs to the site of inflammation. LAMP-1 is a glycoprotein highly expressed in lysosomal membranes. The present study was initiated to test LAMP-1 mRNA and protein levels in post mortem frontal cortex (area 8) of Alzheimer's disease (AD) stages I-IIA/B and stages V-VIC of Braak and Braak, compared with age-matched controls. LAMP-1 occurred in microglia and multinucleated giant cells in one AD case in whom amyloid burden was cleared following betaA-peptide immunization. In addition, LAMP-1 has been suggested to be a cell surface receptor for a specific amelogenin isoform, leucine-rich amelogenin peptide or LRAP. LAMP-1 can serve as a cell surface binding site for amelogenin on dental follicle cells and cementoblasts.

Full Name
lysosomal-associated membrane protein 1
References
  • Parkinson-Lawrence EJ, et al. (2005) Immunochemical analysis of CD107a (LAMP-1). Cell Immunol. 236(1-2): 161-6.
  • Barrachina M, et al. (2006) Lysosome-associated membrane protein 1 (LAMP-1) in Alzheimer's disease. Neuropathol Appl Neurobiol. 32(5): 505-16.
  • Zhang H, et al. (2010) Full length amelogenin binds to cell surface LAMP-1 on tooth root/periodontium associated cells. Arch Oral Biol. 55(6): 417-25.
  • LAMP1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LAMP1 cDNA ORF Clone in Cloning Vector, Rat RG80226-G
    LAMP1 cDNA ORF Clone, Rat, untagged RG80226-UT
    LAMP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80226-ACGLN
    LAMP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80226-ACG
    LAMP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80226-ACR
    LAMP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80226-NF
    LAMP1 cDNA ORF Clone, Rat, C-His tag RG80226-CH
    LAMP1 cDNA ORF Clone, Rat, N-His tag RG80226-NH
    LAMP1 cDNA ORF Clone, Rat, C-HA tag RG80226-CY
    LAMP1 cDNA ORF Clone, Rat, N-HA tag RG80226-NY
    LAMP1 cDNA ORF Clone, Rat, C-Myc tag RG80226-CM
    LAMP1 cDNA ORF Clone, Rat, N-Myc tag RG80226-NM
    LAMP1 qPCR Primer Pairs, Rat RP300216

    LAMP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LAMP1 cDNA ORF Clone in Cloning Vector, Human HG11215-M
    LAMP1 cDNA ORF Clone, Human, untagged HG11215-UT
    LAMP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11215-ACG
    LAMP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11215-ACGLN
    LAMP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11215-ACR
    LAMP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11215-CF
    LAMP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11215-NF
    LAMP1 cDNA ORF Clone, Human, C-His tag HG11215-CH
    LAMP1 cDNA ORF Clone, Human, N-His tag HG11215-NH
    LAMP1 cDNA ORF Clone, Human, C-HA tag HG11215-CY
    LAMP1 cDNA ORF Clone, Human, N-HA tag HG11215-NY
    LAMP1 cDNA ORF Clone, Human, C-Myc tag HG11215-CM
    LAMP1 cDNA ORF Clone, Human, N-Myc tag HG11215-NM
    LAMP1 qPCR Primer Pairs, Human HP100041
    info info
    添加购物车成功! 添加购物车失败!