LAIR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80415-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LAIR1 Reagents
CRO Services
Product recommended

All LAIR1 Reagents
LAIR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Rat leukocyte-associated immunoglobulin-like receptor 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAIR1 Background Information

Leukocyte associated Ig-like receptor-1 (LAIR1) is a surface molecule expressed on human mononuclear leukocytes that functions as an inhibitory receptor on human NK cells. In addition to NK cells, LAIR1 is expressed on T cells, B cells, macrophages, and dendritic cells. It is predicted to mediate inhibitory functions based on the presence of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in its cytoplasmic domain. Cross-linking of LAIR1 on human T cell clones results in inhibition of cytotoxicity only in T cell clones that lack CD28 and are able to spontaneously lyse certain targets in vitro. Moreover, the cytolytic activity of freshly isolated T cells, which is thought to be mainly due to "effector" T cells, can be inhibited by anti-LAIR1 mAb. Thus, LAIR1 functions as an inhibitory receptor not only on NK cells, but also on human T cells. This indicates that LAIR1 provides a mechanism of regulation of effector T cells and may play a role in the inhibition of unwanted bystander responses mediated by Ag-specific T cells. 

Full Name
leukocyte-associated immunoglobulin-like receptor 1
References
  • Meyaard L, et al. (1999) Leukocyte-associated Ig-like receptor-1 functions as an inhibitory receptor on cytotoxic T cells. J Immunol. 162 (10): 5800-4.
  • Meyaard L, et al. (2001) The epithelial cellular adhesion molecule (Ep-CAM) is a ligand for the leukocyte-associated immunoglobulin-like receptor (LAIR). J Exp Med. 194 (1): 107-12.
  • Xu M, et al. (2000) Identification and characterization of leukocyte-associated Ig-like receptor-1 as a major anchor protein of tyrosine phosphatase SHP-1 in hematopoietic cells. J Biol Chem. 275 (23): 17440-6.
  • LAIR1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LAIR1 cDNA ORF Clone in Cloning Vector, Rat RG80415-G
    LAIR1 cDNA ORF Clone, Rat, untagged RG80415-UT
    LAIR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80415-ACGLN
    LAIR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80415-ACG
    LAIR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80415-ACR
    LAIR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80415-CF
    LAIR1 cDNA ORF Clone, Rat, C-His tag RG80415-CH
    LAIR1 cDNA ORF Clone, Rat, N-His tag RG80415-NH
    LAIR1 cDNA ORF Clone, Rat, C-HA tag RG80415-CY
    LAIR1 cDNA ORF Clone, Rat, N-HA tag RG80415-NY
    LAIR1 cDNA ORF Clone, Rat, C-Myc tag RG80415-CM
    LAIR1 cDNA ORF Clone, Rat, N-Myc tag RG80415-NM
    LAIR1 qPCR Primer Pairs, Rat RP300379

    LAIR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LAIR1 cDNA ORF Clone in Cloning Vector, Human HG13257-G
    LAIR1 cDNA ORF Clone, Human, untagged HG13257-UT
    LAIR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13257-ACG
    LAIR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13257-ACGLN
    LAIR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13257-ACR
    LAIR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13257-CF
    LAIR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13257-NF
    LAIR1 cDNA ORF Clone, Human, C-His tag HG13257-CH
    LAIR1 cDNA ORF Clone, Human, N-His tag HG13257-NH
    LAIR1 cDNA ORF Clone, Human, C-HA tag HG13257-CY
    LAIR1 cDNA ORF Clone, Human, N-HA tag HG13257-NY
    LAIR1 cDNA ORF Clone, Human, C-Myc tag HG13257-CM
    LAIR1 cDNA ORF Clone, Human, N-Myc tag HG13257-NM
    LAIR1 qPCR Primer Pairs, Human HP101966

    LAIR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LAIR1 qPCR Primer Pairs, Mouse MP200989
    info info
    添加购物车成功! 添加购物车失败!