LAG3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80367-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LAG3 Reagents
CRO Services
Product recommended

All LAG3 Reagents
LAG3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat lymphocyte-activation gene 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.6kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LAG3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAG3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
LAG3 Background Information

LAG3, also known as CD223 and Lymphocyte activation gene 3, belongs to immunoglobulin (Ig) superfamily. LAG3 contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. It is selectively expressed in activated T and NK cells. LAG3 has a negative regulatory function in T cells. It also acts as as a new marker of T cell induced B cell activation. As a soluble molecule, LAG3 activates antigen-presenting cells through MHC class II signalling, leading to increased antigen-specific T-cell responses in vivo.

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
lymphocyte-activation gene 3
References
  • Sigrid Hannier. et al., 1998, The Journal of Immunology. 161(8): 4058-65.
  • Triebel F. et al., 1990, J Exp Med. 171 (5): 1393-405.
  • Baixeras E. et al., 1992, J Exp Med. 176 (2): 327-37.
  • Huard B. et al., 1997, Proc Natl Acad Sci. 94 (11): 5744-9.
  • Kisielow M. et al., 2005, Eur J Immunol. 35 (7): 2081-8.
  • LAG3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    LAG3 cDNA ORF Clone in Cloning Vector, Rhesus CG90841-G
    LAG3 cDNA ORF Clone, Rhesus, untagged CG90841-UT
    LAG3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90841-ACG
    LAG3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90841-ACGLN
    LAG3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90841-ACR
    LAG3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90841-CF
    LAG3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90841-NF
    LAG3 cDNA ORF Clone, Rhesus, C-His tag CG90841-CH
    LAG3 cDNA ORF Clone, Rhesus, N-His tag CG90841-NH
    LAG3 cDNA ORF Clone, Rhesus, C-HA tag CG90841-CY
    LAG3 cDNA ORF Clone, Rhesus, N-HA tag CG90841-NY
    LAG3 cDNA ORF Clone, Rhesus, C-Myc tag CG90841-CM
    LAG3 cDNA ORF Clone, Rhesus, N-Myc tag CG90841-NM

    LAG3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LAG3 cDNA ORF Clone in Cloning Vector, Rat RG80367-G
    LAG3 cDNA ORF Clone, Rat, untagged RG80367-UT
    LAG3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80367-ACGLN
    LAG3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80367-ACG
    LAG3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80367-ACR
    LAG3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80367-CF
    LAG3 cDNA ORF Clone, Rat, C-His tag RG80367-CH
    LAG3 cDNA ORF Clone, Rat, N-His tag RG80367-NH
    LAG3 cDNA ORF Clone, Rat, C-HA tag RG80367-CY
    LAG3 cDNA ORF Clone, Rat, N-HA tag RG80367-NY
    LAG3 cDNA ORF Clone, Rat, C-Myc tag RG80367-CM
    LAG3 cDNA ORF Clone, Rat, N-Myc tag RG80367-NM
    LAG3 qPCR Primer Pairs, Rat RP300337

    LAG3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LAG3 cDNA ORF Clone in Cloning Vector, Mouse MG53069-G
    LAG3 cDNA ORF Clone, Mouse, untagged MG53069-UT
    LAG3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53069-ACGLN
    LAG3 cDNA ORF Clone, Mouse, C-His tag MG53069-CH

    LAG3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LAG3 cDNA ORF Clone in Cloning Vector, Human HG16498-G
    LAG3 cDNA ORF Clone, Human, untagged HG16498-UT
    LAG3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16498-ACG
    LAG3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16498-ACGLN
    LAG3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16498-ACR
    LAG3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16498-CF
    LAG3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16498-NF
    LAG3 cDNA ORF Clone, Human, C-His tag HG16498-CH
    LAG3 cDNA ORF Clone, Human, N-His tag HG16498-NH
    LAG3 cDNA ORF Clone, Human, C-HA tag HG16498-CY
    LAG3 cDNA ORF Clone, Human, N-HA tag HG16498-NY
    LAG3 cDNA ORF Clone, Human, C-Myc tag HG16498-CM
    LAG3 cDNA ORF Clone, Human, N-Myc tag HG16498-NM
    info info
    添加购物车成功! 添加购物车失败!