KPNA2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81232-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KPNA2 Reagents
CRO Services
Product recommended

All KPNA2 Reagents
KPNA2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1590 bp
Description
Full length Clone DNA of Rat karyopherin alpha 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KPNA2 cDNA ORF Clone, Rat, C-Myc tag Alternative Names
importin cDNA ORF Clone, Rat
KPNA2 Background Information
Full Name
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)

KPNA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
KPNA2 cDNA ORF Clone in Cloning Vector, Rat RG8A6872-U
KPNA2 cDNA ORF Clone in Cloning Vector, Rat RG81232-U
KPNA2 cDNA ORF Clone, Rat, untagged RG81232-UT
KPNA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81232-ACGLN
KPNA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81232-ACG
KPNA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6872-ACGLN
KPNA2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81232-ANG
KPNA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81232-ACR
KPNA2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81232-ANR
KPNA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81232-CF
KPNA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81232-NF
KPNA2 cDNA ORF Clone, Rat, C-His tag RG81232-CH
KPNA2 cDNA ORF Clone, Rat, N-His tag RG81232-NH
KPNA2 cDNA ORF Clone, Rat, C-HA tag RG81232-CY
KPNA2 cDNA ORF Clone, Rat, N-HA tag RG81232-NY
KPNA2 cDNA ORF Clone, Rat, N-Myc tag RG81232-NM
KPNA2 qPCR Primer Pairs, Rat RP301188

KPNA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KPNA2 cDNA ORF Clone in Cloning Vector, Mouse MG53245-U
KPNA2 cDNA ORF Clone, Mouse, untagged MG53245-UT
KPNA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53245-ACG
KPNA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53245-ACGLN
KPNA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53245-ANG
KPNA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53245-ACR
KPNA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53245-ANR
KPNA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53245-CF
KPNA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53245-NF
KPNA2 cDNA ORF Clone, Mouse, C-His tag MG53245-CH
KPNA2 cDNA ORF Clone, Mouse, N-His tag MG53245-NH
KPNA2 cDNA ORF Clone, Mouse, C-HA tag MG53245-CY
KPNA2 cDNA ORF Clone, Mouse, N-HA tag MG53245-NY
KPNA2 cDNA ORF Clone, Mouse, C-Myc tag MG53245-CM
KPNA2 cDNA ORF Clone, Mouse, N-Myc tag MG53245-NM

KPNA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KPNA2 cDNA ORF Clone in Cloning Vector, Human HG14475-G
KPNA2 cDNA ORF Clone, Human, untagged HG14475-UT
KPNA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14475-ACG
KPNA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14475-ACGLN
KPNA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14475-ANG
KPNA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14475-ACR
KPNA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14475-ANR
KPNA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14475-CF
KPNA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14475-NF
KPNA2 cDNA ORF Clone, Human, C-His tag HG14475-CH
KPNA2 cDNA ORF Clone, Human, N-His tag HG14475-NH
KPNA2 cDNA ORF Clone, Human, C-HA tag HG14475-CY
KPNA2 cDNA ORF Clone, Human, N-HA tag HG14475-NY
KPNA2 cDNA ORF Clone, Human, C-Myc tag HG14475-CM
KPNA2 cDNA ORF Clone, Human, N-Myc tag HG14475-NM
KPNA2 qPCR Primer Pairs, Human HP103123
info info
添加购物车成功! 添加购物车失败!