Kininogen 1 cDNA ORF Clone, Rat, untagged

Cat: RG81182-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Kininogen 1 Reagents
CRO Services
Product recommended

All Kininogen 1 Reagents
Kininogen 1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Rat kininogen 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kininogen 1 Background Information

Kininogen-1, also known as high molecular weight kininogen, williams-Fitzgerald-Flaujeac factor, Alpha-2-thiol proteinase inhibitor, Fitzgerald factor, KNG1 and BDK, is a secreted protein which contains three cystatin domains. Kininogen-1 / KNG1 is a protein from the blood coagulation system as well as the kinin-kallikrein system. It is a protein that adsorbs to the surface of biomaterials that come in contact with blood. Kininogen-1 / KNG1 circulates throughout the blood and quickly adsorbs to the material surfaces. Kininogen-1 / KNG1 is one of the early participants of the intrinsic pathway of coagulation, together with Factor XII (Hageman factor) and prekallikrein. Kininogen-1 / KNG1 is one of the kininogens, a class of proteins. As with many other coagulation proteins, the protein was initially named after the patients in whom deficiency was first observed. When the clinical data were combined, it turned out that all patients, in fact, had a deficiency of the same protein. Defects in KNG1 are the cause of high molecular weight kininogen deficiency (HMWK deficiency) which is an autosomal recessive coagulation defect. Patients with HWMK deficiency do not have a hemorrhagic tendency, but they exhibit abnormal surface-mediated activation of fibrinolysis.

Full Name
kininogen 1
References
  • Ohkubo I., et al.,(1984), Isolation of a human cDNA for alpha 2-thiol proteinase inhibitor and its identity with low molecular weight kininogen. Biochemistry 23:5691-5697.
  • Takagaki Y., et al., (1985), Cloning and sequence analysis of cDNAs for human high molecular weight and low molecular weight prekininogens. Primary structures of two human prekininogens.J. Biol. Chem. 260:8601-8609.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Kininogen 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Kininogen 1 cDNA ORF Clone in Cloning Vector, Rat RG81182-U
    Kininogen 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81182-ACGLN
    Kininogen 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81182-ACG
    Kininogen 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81182-ACR
    Kininogen 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81182-CF
    Kininogen 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81182-NF
    Kininogen 1 cDNA ORF Clone, Rat, C-His tag RG81182-CH
    Kininogen 1 cDNA ORF Clone, Rat, N-His tag RG81182-NH
    Kininogen 1 cDNA ORF Clone, Rat, C-HA tag RG81182-CY
    Kininogen 1 cDNA ORF Clone, Rat, N-HA tag RG81182-NY
    Kininogen 1 cDNA ORF Clone, Rat, C-Myc tag RG81182-CM
    Kininogen 1 cDNA ORF Clone, Rat, N-Myc tag RG81182-NM
    Kininogen 1 qPCR Primer Pairs, Rat RP301138

    Kininogen 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Kininogen 1 cDNA ORF Clone in Cloning Vector, Mouse MG50474-M
    Kininogen 1 cDNA ORF Clone, Mouse, untagged MG50474-UT
    Kininogen 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50474-ACGLN
    Kininogen 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50474-ACG
    Kininogen 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50474-ACR
    Kininogen 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50474-CF
    Kininogen 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50474-NF
    Kininogen 1 cDNA ORF Clone, Mouse, C-His tag MG50474-CH
    Kininogen 1 cDNA ORF Clone, Mouse, N-His tag MG50474-NH
    Kininogen 1 cDNA ORF Clone, Mouse, C-HA tag MG50474-CY
    Kininogen 1 cDNA ORF Clone, Mouse, N-HA tag MG50474-NY
    Kininogen 1 cDNA ORF Clone, Mouse, C-Myc tag MG50474-CM
    Kininogen 1 cDNA ORF Clone, Mouse, N-Myc tag MG50474-NM
    Kininogen 1 qPCR Primer Pairs, Mouse MP200094

    Kininogen 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Kininogen 1 cDNA ORF Clone in Cloning Vector, Human HG10529-M
    Kininogen 1 cDNA ORF Clone, Human, untagged HG10529-UT
    Kininogen 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10529-ACGLN
    Kininogen 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10529-ACG
    Kininogen 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10529-ACR
    Kininogen 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10529-CF
    Kininogen 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10529-NF
    Kininogen 1 cDNA ORF Clone, Human, C-His tag HG10529-CH
    Kininogen 1 cDNA ORF Clone, Human, N-His tag HG10529-NH
    Kininogen 1 cDNA ORF Clone, Human, C-HA tag HG10529-CY
    Kininogen 1 cDNA ORF Clone, Human, N-HA tag HG10529-NY
    Kininogen 1 cDNA ORF Clone, Human, C-Myc tag HG10529-CM
    Kininogen 1 cDNA ORF Clone, Human, N-Myc tag HG10529-NM
    Kininogen 1 qPCR Primer Pairs, Human HP100546
    info info
    添加购物车成功! 添加购物车失败!