Quick Order

Rat KNG1/Kininogen 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat KNG1 cDNA Clone Product Information
    NCBI RefSeq:NM_012696.2
    RefSeq ORF Size:1293bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus kininogen 1 with C terminal Flag tag.
    Gene Synonym:Kng, Tkg, Kngk, Kngt, Map1, TKG6, KINKG, KINKH, Kngt1, KINT1G, Kng_v1, Kng1_v1
    Species:Rat
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KNG1 qPCR primers for gene expression analysis, RP301138 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Kininogen-1, also known as high molecular weight kininogen, williams-Fitzgerald-Flaujeac factor, Alpha-2-thiol proteinase inhibitor, Fitzgerald factor, KNG1 and BDK, is a secreted protein which contains three cystatin domains. Kininogen-1 / KNG1 is a protein from the blood coagulation system as well as the kinin-kallikrein system. It is a protein that adsorbs to the surface of biomaterials that come in contact with blood. Kininogen-1 / KNG1 circulates throughout the blood and quickly adsorbs to the material surfaces. Kininogen-1 / KNG1 is one of the early participants of the intrinsic pathway of coagulation, together with Factor XII (Hageman factor) and prekallikrein. Kininogen-1 / KNG1 is one of the kininogens, a class of proteins. As with many other coagulation proteins, the protein was initially named after the patients in whom deficiency was first observed. When the clinical data were combined, it turned out that all patients, in fact, had a deficiency of the same protein. Defects in KNG1 are the cause of high molecular weight kininogen deficiency (HMWK deficiency) which is an autosomal recessive coagulation defect. Patients with HWMK deficiency do not have a hemorrhagic tendency, but they exhibit abnormal surface-mediated activation of fibrinolysis.

    Size / Price
    Catalog: RG81182-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"