NKG2A cDNA ORF Clone, Rat, N-His tag

Cat: RG80370-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NKG2A Reagents
CRO Services
Product recommended

All NKG2A Reagents
NKG2A cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Rat killer cell lectin-like receptor subfamily C, member 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NKG2A Background Information

NKG2, also known as NKG2A(CD159A), is a member of the killer cell lectin-like receptor family. This family is a group of transmembrane proteins preferentially expressed in NK cells. Members of this fmaily are characterized by the type II membrane orientation and the presence of a C-type lectin domain. NKG2 contains 1 C-type lectin domain and forms a complex with another family member, KLRD1/CD94. It is expressed only in NK-cells, but not in T-cells or B-cells. It has been shown that NKG2 represents a family of related cDNA clones, designated NKG2A, NKG2B, NKG2C, and NKG2D, which encode type 2 integral membrane proteins (extracellular C-terminus) containing a C-type lectin domain. Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NKG2 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells.

Full Name
killer cell lectin-like receptor subfamily C, member 1
References
  • Angelini DF, et al. (2011) NKG2A inhibits NKG2C effector functions of gamma delta T cells: implications in health and disease. J Leukoc Biol. 89(1):75-84.
  • Ge SJ, et al. (2011) Expression of NKG2D and NKG2A with their ligands MHC-I A/B and HLA-E in acute leukemia patients and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 19(2):312-6.
  • Ablamunits V, et al. (2011) NKG2A is a marker for acquisition of regulatory function by human CD8+ T cells activated with anti-CD3 antibody. Eur J Immunol. 41(7):1832-42.
  • NKG2A cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    NKG2A cDNA ORF Clone in Cloning Vector, Rhesus CG90214-G
    NKG2A cDNA ORF Clone, Rhesus, untagged CG90214-UT
    NKG2A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90214-ACGLN
    NKG2A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90214-ACG
    NKG2A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90214-ACR
    NKG2A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90214-CF
    NKG2A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90214-NF
    NKG2A cDNA ORF Clone, Rhesus, C-His tag CG90214-CH
    NKG2A cDNA ORF Clone, Rhesus, N-His tag CG90214-NH
    NKG2A cDNA ORF Clone, Rhesus, C-HA tag CG90214-CY
    NKG2A cDNA ORF Clone, Rhesus, N-HA tag CG90214-NY
    NKG2A cDNA ORF Clone, Rhesus, C-Myc tag CG90214-CM
    NKG2A cDNA ORF Clone, Rhesus, N-Myc tag CG90214-NM

    NKG2A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NKG2A cDNA ORF Clone in Cloning Vector, Rat RG80370-G
    NKG2A cDNA ORF Clone, Rat, untagged RG80370-UT
    NKG2A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80370-ACGLN
    NKG2A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80370-ACG
    NKG2A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80370-ACR
    NKG2A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80370-CF
    NKG2A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80370-NF
    NKG2A cDNA ORF Clone, Rat, C-His tag RG80370-CH
    NKG2A cDNA ORF Clone, Rat, C-HA tag RG80370-CY
    NKG2A cDNA ORF Clone, Rat, N-HA tag RG80370-NY
    NKG2A cDNA ORF Clone, Rat, C-Myc tag RG80370-CM
    NKG2A cDNA ORF Clone, Rat, N-Myc tag RG80370-NM
    NKG2A qPCR Primer Pairs, Rat RP300246

    NKG2A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NKG2A cDNA ORF Clone in Cloning Vector, Mouse MG50834-G
    NKG2A cDNA ORF Clone, Mouse, untagged MG50834-UT
    NKG2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50834-ACGLN
    NKG2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50834-ACG
    NKG2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50834-ACR
    NKG2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50834-CF
    NKG2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50834-NF
    NKG2A cDNA ORF Clone, Mouse, C-His tag MG50834-CH
    NKG2A cDNA ORF Clone, Mouse, N-His tag MG50834-NH
    NKG2A cDNA ORF Clone, Mouse, C-HA tag MG50834-CY
    NKG2A cDNA ORF Clone, Mouse, N-HA tag MG50834-NY
    NKG2A cDNA ORF Clone, Mouse, C-Myc tag MG50834-CM
    NKG2A cDNA ORF Clone, Mouse, N-Myc tag MG50834-NM
    NKG2A qPCR Primer Pairs, Mouse MP200805

    NKG2A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NKG2A cDNA ORF Clone in Cloning Vector, Human HG13905-G
    NKG2A cDNA ORF Clone, Human, untagged HG13905-UT
    NKG2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13905-ACGLN
    info info
    添加购物车成功! 添加购物车失败!