Quick Order

Rat NKG2A / NKG2 / CD159A / KLRC1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat KLRC1 cDNA Clone Product Information
    NCBI RefSeq:NM_001037441.1
    RefSeq ORF Size:711bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus killer cell lectin-like receptor subfamily C, member 1 with C terminal His tag.
    Gene Synonym:rNKG2A, Klrc1
    Species:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KLRC1 qPCR primers for gene expression analysis, RP300246 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    NKG2, also known as NKG2A(CD159A), is a member of the killer cell lectin-like receptor family. This family is a group of transmembrane proteins preferentially expressed in NK cells. Members of this fmaily are characterized by the type II membrane orientation and the presence of a C-type lectin domain. NKG2 contains 1 C-type lectin domain and forms a complex with another family member, KLRD1/CD94. It is expressed only in NK-cells, but not in T-cells or B-cells. It has been shown that NKG2 represents a family of related cDNA clones, designated NKG2A, NKG2B, NKG2C, and NKG2D, which encode type 2 integral membrane proteins (extracellular C-terminus) containing a C-type lectin domain. Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NKG2 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells.

    References
  • Angelini DF, et al. (2011) NKG2A inhibits NKG2C effector functions of gamma delta T cells: implications in health and disease. J Leukoc Biol. 89(1):75-84.
  • Ge SJ, et al. (2011) Expression of NKG2D and NKG2A with their ligands MHC-I A/B and HLA-E in acute leukemia patients and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 19(2):312-6.
  • Ablamunits V, et al. (2011) NKG2A is a marker for acquisition of regulatory function by human CD8+ T cells activated with anti-CD3 antibody. Eur J Immunol. 41(7):1832-42.
  • Size / Price
    Catalog: RG80370-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"