Kallikrein 13 cDNA ORF Clone, Rat, C-His tag

Cat: RG80544-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Kallikrein 13 Reagents
CRO Services
Product recommended

All Kallikrein 13 Reagents
Kallikrein 13 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
831 bp
Description
Full length Clone DNA of Rat kallikrein related-peptidase 13 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kallikrein 13 Background Information

Tissue kallikrein 13 (hK13), also known as KLK-L4 (kallikrein-like gene 4), is a member of the human tissue kallikrein family of serine proteases having diverse physiological functions in many tissues. The KLK13 gene resides on chromosome 19q13.3-4 along with other 14 members in a gene cluster and shares a high degree of homology. KLK13 is a trypsin-like, secreted serine protease expressed specifically in the testicular tissue including prostate, salivary gland, breast, and testis. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and may play a role in metastasis. KLK13 may be involved in the pathogenesis and/or progression of breast and ovary cancers, and is regarded as a novel cancer biomarker. In addition, KLK13 interacts and forms complexes with several serum protease inhibitors, such as alpha2-macroglobulin, and its expression is regulated by steroid hormones.

Full Name
kallikrein-related peptidase 13
References
  • Yousef G.M., et al.,(2000), Identification and characterization of KLK-L4, a new kallikrein-like gene that appears to be down-regulated in breast cancer tissues. J. Biol. Chem. 275:11891-11898.
  • Komatsu N., et al., (2003), Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages.J. Invest. Dermatol. 121:542-549.
  • Andres A.M., et al.,(2007), Understanding the accuracy of statistical haplotype inference with sequence data of known phase.Genet. Epidemiol. 31:659-671.
  • Kallikrein 13 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 13 cDNA ORF Clone in Cloning Vector, Rat RG80544-U
    Kallikrein 13 cDNA ORF Clone, Rat, untagged RG80544-UT
    Kallikrein 13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80544-ACG
    Kallikrein 13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80544-ACGLN
    Kallikrein 13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80544-ACR
    Kallikrein 13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80544-CF
    Kallikrein 13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80544-NF
    Kallikrein 13 cDNA ORF Clone, Rat, N-His tag RG80544-NH
    Kallikrein 13 cDNA ORF Clone, Rat, C-HA tag RG80544-CY
    Kallikrein 13 cDNA ORF Clone, Rat, N-HA tag RG80544-NY
    Kallikrein 13 cDNA ORF Clone, Rat, C-Myc tag RG80544-CM
    Kallikrein 13 cDNA ORF Clone, Rat, N-Myc tag RG80544-NM
    Kallikrein 13 qPCR Primer Pairs, Rat RP300508

    Kallikrein 13 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 13 cDNA ORF Clone in Cloning Vector, Human HG10199-M
    Kallikrein 13 cDNA ORF Clone, Human, untagged HG10199-UT
    Kallikrein 13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10199-ACGLN
    Kallikrein 13 cDNA ORF Clone, Human, C-GFPSpark® tag HG10199-ACG
    Kallikrein 13 cDNA ORF Clone, Human, C-OFPSpark® tag HG10199-ACR
    Kallikrein 13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10199-CF
    Kallikrein 13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10199-NF
    Kallikrein 13 cDNA ORF Clone, Human, C-His tag HG10199-CH
    Kallikrein 13 cDNA ORF Clone, Human, N-His tag HG10199-NH
    Kallikrein 13 cDNA ORF Clone, Human, C-HA tag HG10199-CY
    Kallikrein 13 cDNA ORF Clone, Human, N-HA tag HG10199-NY
    Kallikrein 13 cDNA ORF Clone, Human, C-Myc tag HG10199-CM
    Kallikrein 13 cDNA ORF Clone, Human, N-Myc tag HG10199-NM
    Kallikrein 13 qPCR Primer Pairs, Human HP100262

    Kallikrein 13 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 13 qPCR Primer Pairs, Mouse MP200614
    info info
    添加购物车成功! 添加购物车失败!