KIRREL3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80225-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All KIRREL3 Reagents
CRO Services
Product recommended

All KIRREL3 Reagents
KIRREL3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2301 bp
Description
Full length Clone DNA of Rat kin of IRRE like 3 (Drosophila) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KIRREL3 Background Information

Kin of IRRE-like protein 3 (KIRREL3) also known as nin of irregular chiasm-like protein 3 or nephrin-like protein 2 (NEPH2) is a member of the nephrin-like protein family of transmembrane proteins, which includes NEPH1 (KIRREL) and NEPH3 (KIRREL2). KIRREL3/NEPH2 is expressed in fetalv and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of KIRREL3/NEPH2 interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in KIRREL3/NEPH2 are associated with mental retardation autosomal dominant type 4. KIRREL3/NEPH2 expression is turned on in migrating nucleogenesis of the pontine nucleus (PN) neurons only after they enter the presumptive nuclear region. KIRREL3/NEPH2 knockdown disrupted the nuclear organization of PN presumably by changing the migratory behavior of PN neurons inside the nuclear region. Moreover, overexpression of the cytoplasmic region of KIRREL3, which can sequester intracellular signaling of endogenous KIRREL3, resulted in similar phenotypes. Overall, these results suggest KIRREL3 is involved in the nucleogenesis of the PN through the control of neuronal migration inside the nucleus.

Full Name
kin of IRRE like 3 (Drosophila)
References
  • Bhalla K, et al. (2008) Alterations in CDH15 and KIRREL3 in patients with mild to severe intellectual disability. Am J Hum Genet. 83(6): 703-13.
  • Gerke P, et al. (2005) NEPH2 is located at the glomerular slit diaphragm, interacts with nephrin and is cleaved from podocytes by metalloproteinases. J Am Soc Nephrol. 16(6): 1693-702.
  • Gerke P, et al. (2006) Neuronal expression and interaction with the synaptic protein CASK suggest a role for Neph1 and Neph2 in synaptogenesis. J Comp Neurol. 498(4): 466-75.
  • info info
    添加购物车成功! 添加购物车失败!