Quick Order

Text Size:AAA

Rat KIRREL3 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat KIRREL3 cDNA Clone Product Information
NCBI RefSeq:NM_001048215.1
RefSeq ORF Size:2301bp
cDNA Description:Full length Clone DNA of Rattus norvegicus kin of IRRE like 3 (Drosophila) with C terminal Myc tag.
Gene Synonym:Kirrel3
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Kin of IRRE-like protein 3 (KIRREL3) also known as nin of irregular chiasm-like protein 3 or nephrin-like protein 2 (NEPH2) is a member of the nephrin-like protein family of transmembrane proteins, which includes NEPH1 (KIRREL) and NEPH3 (KIRREL2). KIRREL3/NEPH2 is expressed in fetalv and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of KIRREL3/NEPH2 interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in KIRREL3/NEPH2 are associated with mental retardation autosomal dominant type 4. KIRREL3/NEPH2 expression is turned on in migrating nucleogenesis of the pontine nucleus (PN) neurons only after they enter the presumptive nuclear region. KIRREL3/NEPH2 knockdown disrupted the nuclear organization of PN presumably by changing the migratory behavior of PN neurons inside the nuclear region. Moreover, overexpression of the cytoplasmic region of KIRREL3, which can sequester intracellular signaling of endogenous KIRREL3, resulted in similar phenotypes. Overall, these results suggest KIRREL3 is involved in the nucleogenesis of the PN through the control of neuronal migration inside the nucleus.

References
  • Bhalla K, et al. (2008) Alterations in CDH15 and KIRREL3 in patients with mild to severe intellectual disability. Am J Hum Genet. 83(6): 703-13.
  • Gerke P, et al. (2005) NEPH2 is located at the glomerular slit diaphragm, interacts with nephrin and is cleaved from podocytes by metalloproteinases. J Am Soc Nephrol. 16(6): 1693-702.
  • Gerke P, et al. (2006) Neuronal expression and interaction with the synaptic protein CASK suggest a role for Neph1 and Neph2 in synaptogenesis. J Comp Neurol. 498(4): 466-75.
  • Size / Price
    Catalog: RG80225-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"