Quick Order

Rat TIM-1/KIM-1/HACVR Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat HAVCR1 cDNA Clone Product Information
    NCBI RefSeq:NM_173149.1
    RefSeq ORF Size:924bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus hepatitis A virus cellular receptor 1 with C terminal Flag tag.
    Gene Synonym:Kim1, KIM-1, Havcr1
    Species:Rat
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HAVCR1 qPCR primers for gene expression analysis, RP300003 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

    References
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • Size / Price
    Catalog: RG80003-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"