IZUMO4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81606-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IZUMO4 Reagents
CRO Services
Product recommended

All IZUMO4 Reagents
IZUMO4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Rat IZUMO family member 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IZUMO4 Background Information

Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Co-immunoprecipitation studies showed the presence of other sperm proteins associated with Izumo 1, suggesting Izumo 1 forms a multiprotein membrane complex.

Full Name
IZUMO family member 4
References
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ellerman DA, et al. (2009) Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm. Mol Reprod Dev. 76(12):1188-99.
  • IZUMO4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IZUMO4 cDNA ORF Clone in Cloning Vector, Rat RG81606-G
    IZUMO4 cDNA ORF Clone, Rat, untagged RG81606-UT
    IZUMO4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81606-ACG
    IZUMO4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81606-ACGLN
    IZUMO4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81606-ACR
    IZUMO4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81606-NF
    IZUMO4 cDNA ORF Clone, Rat, C-His tag RG81606-CH
    IZUMO4 cDNA ORF Clone, Rat, N-His tag RG81606-NH
    IZUMO4 cDNA ORF Clone, Rat, C-HA tag RG81606-CY
    IZUMO4 cDNA ORF Clone, Rat, N-HA tag RG81606-NY
    IZUMO4 cDNA ORF Clone, Rat, C-Myc tag RG81606-CM
    IZUMO4 cDNA ORF Clone, Rat, N-Myc tag RG81606-NM

    IZUMO4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IZUMO4 cDNA ORF Clone in Cloning Vector, Human HG13249-G
    IZUMO4 cDNA ORF Clone, Human, untagged HG13249-UT
    IZUMO4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13249-ACGLN
    IZUMO4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13249-ACG
    IZUMO4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13249-ACR
    IZUMO4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13249-CF
    IZUMO4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13249-NF
    IZUMO4 cDNA ORF Clone, Human, C-His tag HG13249-CH
    IZUMO4 cDNA ORF Clone, Human, N-His tag HG13249-NH
    IZUMO4 cDNA ORF Clone, Human, C-HA tag HG13249-CY
    IZUMO4 cDNA ORF Clone, Human, N-HA tag HG13249-NY
    IZUMO4 cDNA ORF Clone, Human, C-Myc tag HG13249-CM
    IZUMO4 cDNA ORF Clone, Human, N-Myc tag HG13249-NM
    IZUMO4 qPCR Primer Pairs, Human HP101959
    info info
    添加购物车成功! 添加购物车失败!