ITIH3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81199-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ITIH3 Reagents
CRO Services
Product recommended

All ITIH3 Reagents
ITIH3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2664 bp
Description
Full length Clone DNA of Rat inter-alpha trypsin inhibitor, heavy chain 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITIH3 Background Information
Full Name
inter-alpha-trypsin inhibitor heavy chain 3

ITIH3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ITIH3 cDNA ORF Clone in Cloning Vector, Rat RG81199-G
ITIH3 cDNA ORF Clone, Rat, untagged RG81199-UT
ITIH3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81199-ACG
ITIH3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81199-ACGLN
ITIH3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81199-ACR
ITIH3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81199-NF
ITIH3 cDNA ORF Clone, Rat, C-His tag RG81199-CH
ITIH3 cDNA ORF Clone, Rat, N-His tag RG81199-NH
ITIH3 cDNA ORF Clone, Rat, C-HA tag RG81199-CY
ITIH3 cDNA ORF Clone, Rat, N-HA tag RG81199-NY
ITIH3 cDNA ORF Clone, Rat, C-Myc tag RG81199-CM
ITIH3 cDNA ORF Clone, Rat, N-Myc tag RG81199-NM
ITIH3 qPCR Primer Pairs, Rat RP301155

ITIH3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ITIH3 cDNA ORF Clone in Cloning Vector, Mouse MG53628-U
ITIH3 cDNA ORF Clone, Mouse, untagged MG53628-UT
ITIH3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53628-ACGLN
ITIH3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53628-ACG
ITIH3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53628-ACR
ITIH3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53628-CF
ITIH3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53628-NF
ITIH3 cDNA ORF Clone, Mouse, C-His tag MG53628-CH
ITIH3 cDNA ORF Clone, Mouse, N-His tag MG53628-NH
ITIH3 cDNA ORF Clone, Mouse, C-HA tag MG53628-CY
ITIH3 cDNA ORF Clone, Mouse, N-HA tag MG53628-NY
ITIH3 cDNA ORF Clone, Mouse, C-Myc tag MG53628-CM
ITIH3 cDNA ORF Clone, Mouse, N-Myc tag MG53628-NM
info info
添加购物车成功! 添加购物车失败!