ITFG1/CDA08 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80910-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ITFG1/CDA08 Reagents
CRO Services
Product recommended

All ITFG1/CDA08 Reagents
ITFG1/CDA08 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1833 bp
Description
Full length Clone DNA of Rat integrin alpha FG-GAP repeat containing 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITFG1/CDA08 Background Information
Full Name
integrin alpha FG-GAP repeat containing 1

ITFG1/CDA08 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ITFG1/CDA08 cDNA ORF Clone in Cloning Vector, Rat RG80910-U
ITFG1/CDA08 cDNA ORF Clone, Rat, untagged RG80910-UT
ITFG1/CDA08 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80910-ACG
ITFG1/CDA08 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80910-ACGLN
ITFG1/CDA08 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80910-ACR
ITFG1/CDA08 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80910-CF
ITFG1/CDA08 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80910-NF
ITFG1/CDA08 cDNA ORF Clone, Rat, C-His tag RG80910-CH
ITFG1/CDA08 cDNA ORF Clone, Rat, N-His tag RG80910-NH
ITFG1/CDA08 cDNA ORF Clone, Rat, C-HA tag RG80910-CY
ITFG1/CDA08 cDNA ORF Clone, Rat, N-HA tag RG80910-NY
ITFG1/CDA08 cDNA ORF Clone, Rat, C-Myc tag RG80910-CM
ITFG1/CDA08 qPCR Primer Pairs, Rat RP300874

ITFG1/CDA08 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ITFG1/CDA08 cDNA ORF Clone in Cloning Vector, Mouse MG5A4094-U
ITFG1/CDA08 cDNA ORF Clone, Mouse, untagged MG5A4094-UT
ITFG1/CDA08 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4094-ACG
ITFG1/CDA08 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4094-ACGLN
ITFG1/CDA08 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4094-ACR
ITFG1/CDA08 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4094-CF
ITFG1/CDA08 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4094-NF
ITFG1/CDA08 cDNA ORF Clone, Mouse, C-His tag MG5A4094-CH
ITFG1/CDA08 cDNA ORF Clone, Mouse, N-His tag MG5A4094-NH
ITFG1/CDA08 cDNA ORF Clone, Mouse, C-HA tag MG5A4094-CY
ITFG1/CDA08 cDNA ORF Clone, Mouse, N-HA tag MG5A4094-NY
ITFG1/CDA08 cDNA ORF Clone, Mouse, C-Myc tag MG5A4094-CM
ITFG1/CDA08 cDNA ORF Clone, Mouse, N-Myc tag MG5A4094-NM

ITFG1/CDA08 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ITFG1/CDA08 cDNA ORF Clone in Cloning Vector, Human HG24155-U
ITFG1/CDA08 cDNA ORF Clone, Human, untagged HG24155-UT
ITFG1/CDA08 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG24155-ACGLN
ITFG1/CDA08 cDNA ORF Clone, Human, C-GFPSpark® tag HG24155-ACG
ITFG1/CDA08 cDNA ORF Clone, Human, C-OFPSpark® tag HG24155-ACR
ITFG1/CDA08 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG24155-CF
ITFG1/CDA08 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG24155-NF
ITFG1/CDA08 cDNA ORF Clone, Human, C-His tag HG24155-CH
ITFG1/CDA08 cDNA ORF Clone, Human, N-His tag HG24155-NH
ITFG1/CDA08 cDNA ORF Clone, Human, C-HA tag HG24155-CY
ITFG1/CDA08 cDNA ORF Clone, Human, N-HA tag HG24155-NY
ITFG1/CDA08 cDNA ORF Clone, Human, C-Myc tag HG24155-CM
ITFG1/CDA08 cDNA ORF Clone, Human, N-Myc tag HG24155-NM
info info
添加购物车成功! 添加购物车失败!