Quick Order

Rat Insulin Receptor/INSR/CD220 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat INSR cDNA Clone Product Information
    NCBI RefSeq:NM_017071.2
    RefSeq ORF Size:4155bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus insulin receptor with C terminal Myc tag.
    Gene Synonym:Insr
    Species:Rat
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with INSR qPCR primers for gene expression analysis, RP300095 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

    Size / Price
    Catalog: RG80099-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"