INPP5J/PIB5PA cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81614-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All INPP5J/PIB5PA Reagents
CRO Services
Product recommended

All INPP5J/PIB5PA Reagents
INPP5J/PIB5PA cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3006 bp
Description
Full length Clone DNA of Rat inositol polyphosphate-5-phosphatase J with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

INPP5J/PIB5PA Background Information
Full Name
inositol polyphosphate-5-phosphatase J

INPP5J/PIB5PA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
INPP5J/PIB5PA cDNA ORF Clone in Cloning Vector, Rat RG81614-G
INPP5J/PIB5PA cDNA ORF Clone, Rat, untagged RG81614-UT
INPP5J/PIB5PA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81614-ACGLN
INPP5J/PIB5PA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81614-ACG
INPP5J/PIB5PA cDNA ORF Clone, Rat, N-GFPSpark® tag RG81614-ANG
INPP5J/PIB5PA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81614-ACR
INPP5J/PIB5PA cDNA ORF Clone, Rat, N-OFPSpark® tag RG81614-ANR
INPP5J/PIB5PA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81614-CF
INPP5J/PIB5PA cDNA ORF Clone, Rat, C-His tag RG81614-CH
INPP5J/PIB5PA cDNA ORF Clone, Rat, N-His tag RG81614-NH
INPP5J/PIB5PA cDNA ORF Clone, Rat, C-HA tag RG81614-CY
INPP5J/PIB5PA cDNA ORF Clone, Rat, N-HA tag RG81614-NY
INPP5J/PIB5PA cDNA ORF Clone, Rat, C-Myc tag RG81614-CM
INPP5J/PIB5PA cDNA ORF Clone, Rat, N-Myc tag RG81614-NM

INPP5J/PIB5PA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
INPP5J/PIB5PA cDNA ORF Clone in Cloning Vector, Human HG13987-G
INPP5J/PIB5PA cDNA ORF Clone, Human, untagged HG13987-UT
INPP5J/PIB5PA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13987-ACGLN
INPP5J/PIB5PA cDNA ORF Clone, Human, C-GFPSpark® tag HG13987-ACG
INPP5J/PIB5PA cDNA ORF Clone, Human, N-GFPSpark® tag HG13987-ANG
INPP5J/PIB5PA cDNA ORF Clone, Human, C-OFPSpark® tag HG13987-ACR
INPP5J/PIB5PA cDNA ORF Clone, Human, N-OFPSpark® tag HG13987-ANR
INPP5J/PIB5PA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13987-CF
INPP5J/PIB5PA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13987-NF
INPP5J/PIB5PA cDNA ORF Clone, Human, C-His tag HG13987-CH
INPP5J/PIB5PA cDNA ORF Clone, Human, N-His tag HG13987-NH
INPP5J/PIB5PA cDNA ORF Clone, Human, C-HA tag HG13987-CY
INPP5J/PIB5PA cDNA ORF Clone, Human, N-HA tag HG13987-NY
INPP5J/PIB5PA cDNA ORF Clone, Human, C-Myc tag HG13987-CM
INPP5J/PIB5PA cDNA ORF Clone, Human, N-Myc tag HG13987-NM
INPP5J/PIB5PA qPCR Primer Pairs, Human HP102644
info info
添加购物车成功! 添加购物车失败!