Inhibin beta A cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80051-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Inhibin beta A Reagents
CRO Services
Product recommended

All Inhibin beta A Reagents
Inhibin beta A cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Rat inhibin beta-A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Inhibin beta A Background Information

Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two β subunits, βA βA (activin A), βB βB (activin B), or βA βB (activin AB). Inhibin is composed of an alpha and one of two β subunits, βA (inhibin A) or βB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

Full Name
inhibin, beta A
References
  • Tanimoto K, et al. (1992) Structure and sequence analysis of the human activin beta A subunit gene. DNA Seq. 2 (2): 103-10.
  • Welt C, et al. (2002) Activins, inhibins, and follistatins: from endocrinology to signaling. A paradigm for the new millennium. Exp Biol Med. 227 (9): 724-52.
  • Xu J, et al. (1995) Inhibin antagonizes inhibition of liver cell growth by activin by a dominant-negative mechanism. J Biol Chem. 270 (11): 6308-13.
  • Inhibin beta A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Inhibin beta A cDNA ORF Clone in Cloning Vector, Rat RG80051-M
    Inhibin beta A cDNA ORF Clone, Rat, untagged RG80051-UT
    Inhibin beta A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80051-ACGLN
    Inhibin beta A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80051-ACG
    Inhibin beta A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80051-ACR
    Inhibin beta A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80051-NF
    Inhibin beta A cDNA ORF Clone, Rat, C-His tag RG80051-CH
    Inhibin beta A cDNA ORF Clone, Rat, N-His tag RG80051-NH
    Inhibin beta A cDNA ORF Clone, Rat, C-HA tag RG80051-CY
    Inhibin beta A cDNA ORF Clone, Rat, N-HA tag RG80051-NY
    Inhibin beta A cDNA ORF Clone, Rat, C-Myc tag RG80051-CM
    Inhibin beta A cDNA ORF Clone, Rat, N-Myc tag RG80051-NM
    Inhibin beta A qPCR Primer Pairs, Rat RP300049

    Inhibin beta A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Inhibin beta A cDNA ORF Clone in Cloning Vector, Mouse MG50659-M
    Inhibin beta A cDNA ORF Clone, Mouse, untagged MG50659-UT
    Inhibin beta A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50659-ACGLN
    Inhibin beta A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50659-ACG
    Inhibin beta A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50659-ACR
    Inhibin beta A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50659-CF
    Inhibin beta A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50659-NF
    Inhibin beta A cDNA ORF Clone, Mouse, C-His tag MG50659-CH
    Inhibin beta A cDNA ORF Clone, Mouse, N-His tag MG50659-NH
    Inhibin beta A cDNA ORF Clone, Mouse, C-HA tag MG50659-CY
    Inhibin beta A cDNA ORF Clone, Mouse, N-HA tag MG50659-NY
    Inhibin beta A cDNA ORF Clone, Mouse, C-Myc tag MG50659-CM
    Inhibin beta A cDNA ORF Clone, Mouse, N-Myc tag MG50659-NM
    Inhibin beta A qPCR Primer Pairs, Mouse MP200638

    Inhibin beta A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Inhibin beta A cDNA ORF Clone in Cloning Vector, Human HG10429-M
    Inhibin beta A cDNA ORF Clone, Human, untagged HG10429-UT
    Inhibin beta A cDNA ORF Clone, Human, C-GFPSpark® tag HG10429-ACG
    Inhibin beta A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10429-ACGLN
    Inhibin beta A cDNA ORF Clone, Human, C-OFPSpark® tag HG10429-ACR
    Inhibin beta A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10429-CF
    Inhibin beta A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10429-NF
    Inhibin beta A cDNA ORF Clone, Human, C-His tag HG10429-CH
    Inhibin beta A cDNA ORF Clone, Human, N-His tag HG10429-NH
    Inhibin beta A cDNA ORF Clone, Human, C-HA tag HG10429-CY
    Inhibin beta A cDNA ORF Clone, Human, N-HA tag HG10429-NY
    Inhibin beta A cDNA ORF Clone, Human, C-Myc tag HG10429-CM
    Inhibin beta A cDNA ORF Clone, Human, N-Myc tag HG10429-NM
    Inhibin beta A qPCR Primer Pairs, Human HP100459
    info info
    添加购物车成功! 添加购物车失败!