IMP4 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81162-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IMP4 Reagents
CRO Services
Product recommended

All IMP4 Reagents
IMP4 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Rat IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IMP4 cDNA ORF Clone, Rat, C-Myc tag Alternative Names
LRRGT00017 cDNA ORF Clone, Rat;RGD1308463 cDNA ORF Clone, Rat
IMP4 Background Information
Full Name
IMP4, U3 small nucleolar ribonucleoprotein

IMP4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IMP4 cDNA ORF Clone in Cloning Vector, Rat RG81162-U
IMP4 cDNA ORF Clone, Rat, untagged RG81162-UT
IMP4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81162-ACGLN
IMP4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81162-ACG
IMP4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81162-ANG
IMP4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81162-ACR
IMP4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81162-ANR
IMP4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81162-CF
IMP4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81162-NF
IMP4 cDNA ORF Clone, Rat, C-His tag RG81162-CH
IMP4 cDNA ORF Clone, Rat, N-His tag RG81162-NH
IMP4 cDNA ORF Clone, Rat, C-HA tag RG81162-CY
IMP4 cDNA ORF Clone, Rat, N-HA tag RG81162-NY
IMP4 cDNA ORF Clone, Rat, N-Myc tag RG81162-NM
IMP4 qPCR Primer Pairs, Rat RP301118

IMP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IMP4 cDNA ORF Clone in Cloning Vector, Mouse MG53317-U
IMP4 cDNA ORF Clone, Mouse, untagged MG53317-UT
IMP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53317-ACGLN
IMP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53317-ACG
IMP4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53317-ANG
IMP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53317-ACR
IMP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53317-ANR
IMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53317-CF
IMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53317-NF
IMP4 cDNA ORF Clone, Mouse, C-His tag MG53317-CH
IMP4 cDNA ORF Clone, Mouse, N-His tag MG53317-NH
IMP4 cDNA ORF Clone, Mouse, C-HA tag MG53317-CY
IMP4 cDNA ORF Clone, Mouse, N-HA tag MG53317-NY
IMP4 cDNA ORF Clone, Mouse, C-Myc tag MG53317-CM
IMP4 cDNA ORF Clone, Mouse, N-Myc tag MG53317-NM

IMP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IMP4 cDNA ORF Clone in Cloning Vector, Human HG16544-U
IMP4 cDNA ORF Clone, Human, untagged HG16544-UT
IMP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16544-ACGLN
IMP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16544-ACG
IMP4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16544-ANG
IMP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16544-ACR
IMP4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16544-ANR
IMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16544-CF
IMP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16544-NF
IMP4 cDNA ORF Clone, Human, C-His tag HG16544-CH
IMP4 cDNA ORF Clone, Human, N-His tag HG16544-NH
IMP4 cDNA ORF Clone, Human, C-HA tag HG16544-CY
IMP4 cDNA ORF Clone, Human, N-HA tag HG16544-NY
IMP4 cDNA ORF Clone, Human, C-Myc tag HG16544-CM
IMP4 cDNA ORF Clone, Human, N-Myc tag HG16544-NM
info info
添加购物车成功! 添加购物车失败!