IL-F2/ILF2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80668-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-F2/ILF2 Reagents
CRO Services
Product recommended

All IL-F2/ILF2 Reagents
IL-F2/ILF2 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Rat interleukin enhancer binding factor 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-F2/ILF2 cDNA ORF Clone, Rat, N-HA tag Alternative Names
Ab1-143 cDNA ORF Clone, Rat
IL-F2/ILF2 Background Information
Full Name
interleukin enhancer binding factor 2

IL-F2/ILF2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
IL-F2/ILF2 cDNA ORF Clone in Cloning Vector, Ferret FG60119-G
IL-F2/ILF2 cDNA ORF Clone, Ferret, untagged FG60119-UT
IL-F2/ILF2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60119-ACGLN
IL-F2/ILF2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60119-ACG
IL-F2/ILF2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60119-ANG
IL-F2/ILF2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60119-ACR
IL-F2/ILF2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60119-ANR
IL-F2/ILF2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60119-CF
IL-F2/ILF2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60119-NF
IL-F2/ILF2 cDNA ORF Clone, Ferret, C-His tag FG60119-CH
IL-F2/ILF2 cDNA ORF Clone, Ferret, N-His tag FG60119-NH
IL-F2/ILF2 cDNA ORF Clone, Ferret, C-HA tag FG60119-CY
IL-F2/ILF2 cDNA ORF Clone, Ferret, N-HA tag FG60119-NY
IL-F2/ILF2 cDNA ORF Clone, Ferret, C-Myc tag FG60119-CM
IL-F2/ILF2 cDNA ORF Clone, Ferret, N-Myc tag FG60119-NM

IL-F2/ILF2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IL-F2/ILF2 cDNA ORF Clone in Cloning Vector, Rat RG80668-U
IL-F2/ILF2 cDNA ORF Clone in Cloning Vector, Rat RG8A6942-U
IL-F2/ILF2 cDNA ORF Clone, Rat, untagged RG80668-UT
IL-F2/ILF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80668-ACGLN
IL-F2/ILF2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80668-ACG
IL-F2/ILF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6942-ACGLN
IL-F2/ILF2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80668-ANG
IL-F2/ILF2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80668-ACR
IL-F2/ILF2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80668-ANR
IL-F2/ILF2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80668-CF
IL-F2/ILF2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80668-NF
IL-F2/ILF2 cDNA ORF Clone, Rat, C-His tag RG80668-CH
IL-F2/ILF2 cDNA ORF Clone, Rat, N-His tag RG80668-NH
IL-F2/ILF2 cDNA ORF Clone, Rat, C-HA tag RG80668-CY
IL-F2/ILF2 cDNA ORF Clone, Rat, C-Myc tag RG80668-CM
IL-F2/ILF2 cDNA ORF Clone, Rat, N-Myc tag RG80668-NM
IL-F2/ILF2 qPCR Primer Pairs, Rat RP300632

IL-F2/ILF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL-F2/ILF2 cDNA ORF Clone in Cloning Vector, Mouse MG52448-G
IL-F2/ILF2 cDNA ORF Clone, Mouse, untagged MG52448-UT
IL-F2/ILF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52448-ACGLN
IL-F2/ILF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52448-ACG
IL-F2/ILF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52448-ANG
IL-F2/ILF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52448-ACR
IL-F2/ILF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52448-ANR
IL-F2/ILF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52448-CF
IL-F2/ILF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52448-NF
IL-F2/ILF2 cDNA ORF Clone, Mouse, C-His tag MG52448-CH
IL-F2/ILF2 cDNA ORF Clone, Mouse, N-His tag MG52448-NH
IL-F2/ILF2 cDNA ORF Clone, Mouse, C-HA tag MG52448-CY
IL-F2/ILF2 cDNA ORF Clone, Mouse, N-HA tag MG52448-NY
IL-F2/ILF2 cDNA ORF Clone, Mouse, C-Myc tag MG52448-CM
IL-F2/ILF2 cDNA ORF Clone, Mouse, N-Myc tag MG52448-NM
IL-F2/ILF2 qPCR Primer Pairs, Mouse MP202321

IL-F2/ILF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL-F2/ILF2 cDNA ORF Clone in Cloning Vector, Human HG16905-U
IL-F2/ILF2 cDNA ORF Clone, Human, untagged HG16905-UT
IL-F2/ILF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16905-ACG
IL-F2/ILF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16905-ACGLN
IL-F2/ILF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16905-ANG
IL-F2/ILF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16905-ACR
IL-F2/ILF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16905-ANR
IL-F2/ILF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16905-CF
IL-F2/ILF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16905-NF
IL-F2/ILF2 cDNA ORF Clone, Human, C-His tag HG16905-CH
IL-F2/ILF2 cDNA ORF Clone, Human, N-His tag HG16905-NH
IL-F2/ILF2 cDNA ORF Clone, Human, C-HA tag HG16905-CY
IL-F2/ILF2 cDNA ORF Clone, Human, N-HA tag HG16905-NY
IL-F2/ILF2 cDNA ORF Clone, Human, C-Myc tag HG16905-CM
IL-F2/ILF2 cDNA ORF Clone, Human, N-Myc tag HG16905-NM
info info
添加购物车成功! 添加购物车失败!