IL9R cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80077-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL9R Reagents
CRO Services
Product recommended

All IL9R Reagents
IL9R cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Rat interleukin 9 receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL9R Background Information
Full Name
interleukin 9 receptor
References
  • Demoulin JB. et al. (1998) Interleukin 9 and its receptor: an overview of structure and function. Int Rev Immunol. 16 (3-4): 345-64.
  • Sliva D. et al. (1999) Tip60 interacts with human interleukin-9 receptor alpha-chain. Biochem Biophys Res Commun. 263 (1): 149-55.
  • Renauld JC. et al. (1995) Interleukin-9 and its receptor: involvement in mast cell differentiation and T cell oncogenesis. J Leukoc Biol. 57 (3): 353-60.
  • IL9R cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL9R cDNA ORF Clone in Cloning Vector, Rhesus CG90327-G
    IL9R cDNA ORF Clone, Rhesus, untagged CG90327-UT
    IL9R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90327-ACGLN
    IL9R cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90327-ACG
    IL9R cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90327-ACR
    IL9R cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90327-CF
    IL9R cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90327-NF
    IL9R cDNA ORF Clone, Rhesus, C-His tag CG90327-CH
    IL9R cDNA ORF Clone, Rhesus, N-His tag CG90327-NH
    IL9R cDNA ORF Clone, Rhesus, C-HA tag CG90327-CY
    IL9R cDNA ORF Clone, Rhesus, N-HA tag CG90327-NY
    IL9R cDNA ORF Clone, Rhesus, C-Myc tag CG90327-CM
    IL9R cDNA ORF Clone, Rhesus, N-Myc tag CG90327-NM

    IL9R cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL9R cDNA ORF Clone in Cloning Vector, Rat RG80077-M
    IL9R cDNA ORF Clone, Rat, untagged RG80077-UT
    IL9R cDNA ORF Clone, Rat, C-GFPSpark® tag RG80077-ACG
    IL9R Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80077-ACGLN
    IL9R cDNA ORF Clone, Rat, C-OFPSpark® tag RG80077-ACR
    IL9R cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80077-CF
    IL9R cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80077-NF
    IL9R cDNA ORF Clone, Rat, C-His tag RG80077-CH
    IL9R cDNA ORF Clone, Rat, N-His tag RG80077-NH
    IL9R cDNA ORF Clone, Rat, C-HA tag RG80077-CY
    IL9R cDNA ORF Clone, Rat, N-HA tag RG80077-NY
    IL9R cDNA ORF Clone, Rat, N-Myc tag RG80077-NM
    IL9R qPCR Primer Pairs, Rat RP300073

    IL9R cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL9R cDNA ORF Clone, Human, untagged HG13049-UT
    IL9R Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13049-ACGLN
    IL9R qPCR Primer Pairs, Human HP104617
    info info
    添加购物车成功! 添加购物车失败!