IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80199-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL8Rb/CXCR2/CD182 Reagents
CRO Services
Product recommended

All IL8Rb/CXCR2/CD182 Reagents
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Rat interleukin 8 receptor, beta with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About IL8Rb/CXCR2/CD182
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL8Rb/CXCR2/CD182 Background Information
Full Name
chemokine (C-X-C motif) receptor 2

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Rhesus CG90118-G
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, untagged CG90118-UT
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90118-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90118-ACG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90118-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90118-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90118-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-His tag CG90118-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-His tag CG90118-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-HA tag CG90118-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-HA tag CG90118-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-Myc tag CG90118-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-Myc tag CG90118-NM

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Rat RG80199-G
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, untagged RG80199-UT
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80199-ACG
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80199-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80199-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80199-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-His tag RG80199-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-His tag RG80199-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-HA tag RG80199-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-HA tag RG80199-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-Myc tag RG80199-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-Myc tag RG80199-NM
IL8Rb/CXCR2/CD182 qPCR Primer Pairs, Rat RP300191

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Mouse MG50833-G
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, untagged MG50833-UT
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50833-ACG
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50833-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50833-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50833-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50833-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-His tag MG50833-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-His tag MG50833-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-HA tag MG50833-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-HA tag MG50833-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-Myc tag MG50833-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-Myc tag MG50833-NM
IL8Rb/CXCR2/CD182 qPCR Primer Pairs, Mouse MP200804

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Human HG10788-M
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, untagged HG10788-UT
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10788-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-GFPSpark® tag HG10788-ACG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-GFPSpark® tag HG10788-ANG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-OFPSpark® tag HG10788-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10788-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10788-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-His tag HG10788-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-His tag HG10788-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-HA tag HG10788-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-HA tag HG10788-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-Myc tag HG10788-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag HG10788-NM
IL8Rb/CXCR2/CD182 qPCR Primer Pairs, Human HP100702
info info
添加购物车成功! 添加购物车失败!