Quick Order

Rat IL-17E/IL-25 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat IL25 cDNA Clone Product Information
    NCBI RefSeq:NM_001192007.1
    RefSeq ORF Size:510bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 25 with N terminal Flag tag.
    Gene Synonym:RGD1561632, Il25
    Species:Rat
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL25 qPCR primers for gene expression analysis, RP300186 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. IL-25 is a member of the IL-17 family of cytokines. However, unlike the other members of this family, IL-25 promotes T helper (Th) 2 responses. IL-25 also regulates the development of autoimmune inflammation mediated by IL-17–producing T cells. IL-25 and IL-17, being members of the same cytokine family, play opposing roles in the pathogenesis of organ-specific autoimmunity. IL-25 promotes cell expansion and Th2 cytokine production when Th2 central memory cells are stimulated with thymic stromal lymphopoietin (TSLP)–activated dendritic cells (DCs), homeostatic cytokines, or T cell receptor for antigen triggering. Elevated expression of IL-25 and IL-25R transcripts was observed in asthmatic lung tissues and atopic dermatitis skin lesions, linking their possible roles with exacerbated allergic disorders. A plausible explanation that IL-25 produced by innate effector eosinophils and basophils may augment the allergic inflammation by enhancing the maintenance and functions of adaptive Th2 memory cells had been provided.

    References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Tamachi T, et al.. (2006) IL-25 enhances allergic airway inflammation by amplifying a TH2 cell-dependent pathway in mice. J Allergy Clin Immunol. 118(3): 606-14.
  • Kleinschek MA, et al.. (2007) IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 204(1): 161-70.
  • Size / Price
    Catalog: RG80194-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"