After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat IL-22R / IL22RA1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Rat IL22RA1 cDNA Clone Product Information
NCBI RefSeq:NM_001191869.1
RefSeq ORF Size:1734bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin22receptor,alpha1 with C terminal His tag.
Gene Synonym:RGD1559655, Il22ra1
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed in colon, liver, lung, pancreas and kidney. IL-22R also can be expressed in keratinocytes of normal skin as well as in psoriatic skin lesion. Overexpression of IL-22R can be detected in synovial fluid cells from rheumatoid arthritis and spondyloarthropathy patients. IL-22R is a component of the receptor for IL20, IL22 and IL24. The component of IL-22R formed by IL22RA1 and IL10RB enables IL22 signaling via JAK/STAT pathways. IL22 also induces activation of MAPK1/MAPK3 and Akt kinases pathways. Component of one of the receptor for IL20 and IL24 formed by IL22RA1 and IL20RB also signaling through STATs activation. IL-22R mediates IL24 antiangiogenic activity as well as IL24 inhibitory effect on endothelial cell tube formation and differentiation.

References
  • Xie MH, et al. (2000) Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. 275(40):31335-9.
  • Xu W, et al. (2001) A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc Natl Acad Sci. 98(17):9511-6.
  • Wu PW, et al. (2008) IL-22R, IL-10R2, and IL-22BP binding sites are topologically juxtaposed on adjacent and overlapping surfaces of IL-22. J Mol Biol. 382(5):1168-83.
  • Size / Price
    Catalog: RG80453-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"