Quick Order

Text Size:AAA

Rat IL22 / Interleukin 22 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Rat IL22 cDNA Clone Product Information
NCBI RefSeq:NM_001191988.1
RefSeq ORF Size:540bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 22 with C terminal His tag.
Gene Synonym:RGD1561292
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

IL22 is a member of a group of cytokines called the IL-10 family or IL-10 superfamily (including IL-19, IL-20, IL-24, and IL-26),  a class of potent mediators of cellular inflammatory responses. It shares use of IL-10R2 in cell signaling with other members of this family, IL-10, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems.

IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-10 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S100s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-10. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.

References
  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
  • Size / Price
    Catalog: RG80463-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"