IL21 Receptor cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80189-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL21 Receptor Reagents
CRO Services
Product recommended

All IL21 Receptor Reagents
IL21 Receptor cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1566 bp
Description
Full length Clone DNA of Rat interleukin 21 receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL21 Receptor Background Information

Interleukin-21 receptor, also known as IL-21 receptor, IL-21R, Novel interleukin receptor, IL21R and NILR, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 4 subfamily. Interleukin-21 (IL-21) belongs to a family of cytokines that bind to a composite receptor consisting of a private receptor (IL-21R) and the common cytokine receptor gamma chain ( gamma(C) ). The IL-21R is discovered as a novel member of the class-I-cytokine-receptor family and is selectively expressed in lymphoid tissues. IL-21R shows strong sequence homologies to the interleukin-4 receptor alpha chain gene (IL-4RA). The WSXWS motif of IL-21R appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif of IL-21R is required for JAK interaction and / or activation. The IL-21R is widely distributed on lympho-haematopoietic cells and IL21 impacts a number of cell types, including CD8+ memory T cells, NK cells and subsets of CD4 memory T cells. Increased IL21 production is characteristic of certain autoimmune diseases and is likely to contribute to autoantibody production as well as pathological features of autoimmune disease. The critical role of IL21 in promoting humoral immune responses makes it an important focus of potential therapeutic interventions in conditions characterised by overproduction of pathogenic autoantibodies.

Full Name
interleukin 21 receptor
References
  • Asao H, et al. (2001) Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol. 167(1): 1-5.
  • Wu Z, et al. (2005) Interleukin-21 receptor gene induction in human T cells is mediated by T-cell receptor-induced Sp1 activity. Mol Cell Biol. 25(22): 9741-52.
  • De Totero D, et al. (2006) Interleukin-21 receptor (IL-21R) is up-regulated by CD40 triggering and mediates proapoptotic signals in chronic lymphocytic leukemia B cells. Blood. 107(9): 3708-15.
  •  

    info info
    添加购物车成功! 添加购物车失败!