IL-20 cDNA ORF Clone, Rat, C-His tag

Cat: RG80422-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-20 Reagents
CRO Services
Product recommended

All IL-20 Reagents
IL-20 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat interleukin 20 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-20 Background Information

IL20/Interleukin-20 belongs to the IL-10 family. It is a cytokine structurally related to interleukin 10. IL20/Interleukin-20 can be detected in skin, trachea, and other tissues. It is produced by activated keratinocytes and monocytes and transmits an intracellular signal through two distinct cell-surface receptor complexes on keratinocytes and other epithelial cells.It has been shown that interleukin-20 transduce its signal through signal transducer and activator of transcription 3 (STAT3) in keratinocytes. It may be involved in epidermal function and psoriasis. It also regulates proliferation and differentiation of keratinocytes during inflammation, particularly inflammation associated with the skin. In addition, IL20/Interleukin-20 also causes cell expansion of multipotential hematopoietic progenitor cells. A specific receptor for this cytokine is found to be expressed in skin and upregulated dramatically in psoriatic skin, suggesting a role for this protein in epidermal function and psoriasis.

Full Name
interleukin 20
References
  • Chen XY, et al. (2011) The association between the IL-20-1723CG allele on the 1q chromosome and psoriasis triggered or exacerbated by an upper respiratory tract infection in the Chinese Han population. Dermatology. 222(1):24-30.
  • Baird AM, et al. (2011) IL-20 is epigenetically regulated in NSCLC and down regulates the expression of VEGF. Eur J Cancer. 47(12):1908-18.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • IL-20 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-20 cDNA ORF Clone in Cloning Vector, Rat RG80422-G
    IL-20 cDNA ORF Clone, Rat, untagged RG80422-UT
    IL-20 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80422-ACG
    IL-20 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80422-ACGLN
    IL-20 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80422-ACR
    IL-20 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80422-CF
    IL-20 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80422-NF
    IL-20 cDNA ORF Clone, Rat, N-His tag RG80422-NH
    IL-20 cDNA ORF Clone, Rat, C-HA tag RG80422-CY
    IL-20 cDNA ORF Clone, Rat, N-HA tag RG80422-NY
    IL-20 cDNA ORF Clone, Rat, C-Myc tag RG80422-CM
    IL-20 cDNA ORF Clone, Rat, N-Myc tag RG80422-NM
    IL-20 qPCR Primer Pairs, Rat RP300386

    IL-20 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-20 cDNA ORF Clone in Cloning Vector, Mouse MG51307-G
    IL-20 cDNA ORF Clone, Mouse, untagged MG51307-UT
    IL-20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51307-ACGLN
    IL-20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51307-ACG
    IL-20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51307-ACR
    IL-20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51307-CF
    IL-20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51307-NF
    IL-20 cDNA ORF Clone, Mouse, C-His tag MG51307-CH
    IL-20 cDNA ORF Clone, Mouse, N-His tag MG51307-NH
    IL-20 cDNA ORF Clone, Mouse, C-HA tag MG51307-CY
    IL-20 cDNA ORF Clone, Mouse, N-HA tag MG51307-NY
    IL-20 cDNA ORF Clone, Mouse, C-Myc tag MG51307-CM
    IL-20 cDNA ORF Clone, Mouse, N-Myc tag MG51307-NM
    IL-20 qPCR Primer Pairs, Mouse MP201185

    IL-20 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-20 cDNA ORF Clone, Human, untagged HG13060-UT
    IL-20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13060-ACGLN
    IL-20 qPCR Primer Pairs, Human HP104626
    info info
    添加购物车成功! 添加购物车失败!