Quick Order

Rat interleukin-20 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Rat IL20 cDNA Clone Product Information
NCBI RefSeq:NM_001143881.1
RefSeq ORF Size:531bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 20 with N terminal His tag.
Gene Synonym:Il20
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

IL20/Interleukin-20 belongs to the IL-10 family. It is a cytokine structurally related to interleukin 10. IL20/Interleukin-20 can be detected in skin, trachea, and other tissues. It is produced by activated keratinocytes and monocytes and transmits an intracellular signal through two distinct cell-surface receptor complexes on keratinocytes and other epithelial cells.It has been shown that interleukin-20 transduce its signal through signal transducer and activator of transcription 3 (STAT3) in keratinocytes. It may be involved in epidermal function and psoriasis. It also regulates proliferation and differentiation of keratinocytes during inflammation, particularly inflammation associated with the skin. In addition, IL20/Interleukin-20 also causes cell expansion of multipotential hematopoietic progenitor cells. A specific receptor for this cytokine is found to be expressed in skin and upregulated dramatically in psoriatic skin, suggesting a role for this protein in epidermal function and psoriasis.

References
  • Chen XY, et al. (2011) The association between the IL-20-1723CG allele on the 1q chromosome and psoriasis triggered or exacerbated by an upper respiratory tract infection in the Chinese Han population. Dermatology. 222(1):24-30.
  • Baird AM, et al. (2011) IL-20 is epigenetically regulated in NSCLC and down regulates the expression of VEGF. Eur J Cancer. 47(12):1908-18.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Size / Price
    Catalog: RG80422-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"