IL1RA cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80073-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL1RA Reagents
CRO Services
Product recommended

All IL1RA Reagents
IL1RA cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Rat interleukin 1 receptor antagonist with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL1RA Background Information

Interleukin-1 receptor antagonist (IL-1RA) also known as IL1RN is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. A polymorphism of this protein encoding gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. IL-1RA/IL1RN may inhibit the activity of IL-1 by binding to its receptor and it has no IL-1 like activity. Genetic variation in IL-1RA/IL1RN is associated with susceptibility to microvascular complications of diabetes type 4 (MVCD4). These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. Defects in IL-1RA/IL1RN are the cause of interleukin 1 receptor antagonist deficiency (DIRA) which is also known as deficiency of interleukin 1 receptor antagonist. Autoinflammatory diseases manifest inflammation without evidence of infection, high-titer autoantibodies, or autoreactive T-cells. DIRA is a rare, autosomal recessive, genetic autoinflammatory disease that results in sterile multifocal osteomyelitis, and pustulosis from birth.

Full Name
interleukin 1 receptor antagonist
References
  • Langdahl BL, et al. (2000) Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. J Bone Miner. 15 (3): 402-14.
  • El-Omar EM, et al. (2000) Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 404 (6776): 398-402.
  • Steinkasserer A, et al. (1992) The human IL-1 receptor antagonist gene (IL1RN) maps to chromosome 2q14-q21, in the region of the IL-1 alpha and IL-1 beta loci. Genomics. 13 (3): 654-7.
  • IL1RA cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    IL1RA cDNA ORF Clone in Cloning Vector, Ferret FG60143-G
    IL1RA cDNA ORF Clone, Ferret, untagged FG60143-UT
    IL1RA Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60143-ACGLN
    IL1RA cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60143-ACG
    IL1RA cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60143-ACR
    IL1RA cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60143-CF
    IL1RA cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60143-NF
    IL1RA cDNA ORF Clone, Ferret, C-His tag FG60143-CH
    IL1RA cDNA ORF Clone, Ferret, N-His tag FG60143-NH
    IL1RA cDNA ORF Clone, Ferret, C-HA tag FG60143-CY
    IL1RA cDNA ORF Clone, Ferret, N-HA tag FG60143-NY
    IL1RA cDNA ORF Clone, Ferret, C-Myc tag FG60143-CM
    IL1RA cDNA ORF Clone, Ferret, N-Myc tag FG60143-NM

    IL1RA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL1RA cDNA ORF Clone in Cloning Vector, Rat RG80073-M
    IL1RA cDNA ORF Clone, Rat, untagged RG80073-UT
    IL1RA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80073-ACG
    IL1RA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80073-ACGLN
    IL1RA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80073-ACR
    IL1RA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80073-CF
    IL1RA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80073-NF
    IL1RA cDNA ORF Clone, Rat, C-His tag RG80073-CH
    IL1RA cDNA ORF Clone, Rat, N-His tag RG80073-NH
    IL1RA cDNA ORF Clone, Rat, C-HA tag RG80073-CY
    IL1RA cDNA ORF Clone, Rat, N-HA tag RG80073-NY
    IL1RA cDNA ORF Clone, Rat, N-Myc tag RG80073-NM
    IL1RA qPCR Primer Pairs, Rat RP300069

    IL1RA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL1RA cDNA ORF Clone in Cloning Vector, Mouse MG51300-G
    IL1RA cDNA ORF Clone, Mouse, untagged MG51300-UT
    IL1RA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51300-ACGLN
    IL1RA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51300-ACG
    IL1RA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51300-ACR
    IL1RA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51300-CF
    IL1RA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51300-NF
    IL1RA cDNA ORF Clone, Mouse, C-His tag MG51300-CH
    IL1RA cDNA ORF Clone, Mouse, N-His tag MG51300-NH
    IL1RA cDNA ORF Clone, Mouse, C-HA tag MG51300-CY
    IL1RA cDNA ORF Clone, Mouse, N-HA tag MG51300-NY
    IL1RA cDNA ORF Clone, Mouse, C-Myc tag MG51300-CM
    IL1RA cDNA ORF Clone, Mouse, N-Myc tag MG51300-NM
    IL1RA qPCR Primer Pairs, Mouse MP201178

    IL1RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL1RA cDNA ORF Clone in Cloning Vector, Human HG13245-G
    IL1RA cDNA ORF Clone in Cloning Vector, Human HG10123-M
    IL1RA cDNA ORF Clone, Human, untagged HG13245-UT
    IL1RA cDNA ORF Clone, Human, untagged HG10123-UT
    IL1RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10123-ACG
    IL1RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10123-ACGLN
    IL1RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13245-ACGLN
    IL1RA cDNA ORF Clone, Human, C-GFPSpark® tag HG13245-ACG
    IL1RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10123-ACR
    IL1RA cDNA ORF Clone, Human, C-OFPSpark® tag HG13245-ACR
    IL1RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10123-CF
    IL1RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13245-CF
    IL1RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10123-NF
    IL1RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13245-NF
    IL1RA cDNA ORF Clone, Human, C-His tag HG10123-CH
    IL1RA cDNA ORF Clone, Human, C-His tag HG13245-CH
    IL1RA cDNA ORF Clone, Human, N-His tag HG13245-NH
    IL1RA cDNA ORF Clone, Human, N-His tag HG10123-NH
    IL1RA cDNA ORF Clone, Human, C-HA tag HG13245-CY
    IL1RA cDNA ORF Clone, Human, C-HA tag HG10123-CY
    IL1RA cDNA ORF Clone, Human, N-HA tag HG13245-NY
    IL1RA cDNA ORF Clone, Human, N-HA tag HG10123-NY
    IL1RA cDNA ORF Clone, Human, C-Myc tag HG13245-CM
    IL1RA cDNA ORF Clone, Human, C-Myc tag HG10123-CM
    IL1RA cDNA ORF Clone, Human, N-Myc tag HG10123-NM
    IL1RA cDNA ORF Clone, Human, N-Myc tag HG13245-NM
    IL1RA qPCR Primer Pairs, Human HP100096
    info info
    添加购物车成功! 添加购物车失败!