Text Size:AAA

Rat IL1R1/IL-1R1/IL-1 RI Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat IL1R1 cDNA Clone Product Information
NCBI RefSeq:NM_013123.3
RefSeq ORF Size:1773bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 1 receptor, type I with C terminal HA tag.
Gene Synonym:Il1r1
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interleukin 1 receptor, type I (IL-1R1) also known as CD121a (Cluster of Differentiation 121a), is an interleukin receptor. IL-1R1/CD121a is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein is a receptor for interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA). IL-1R1/CD121a is an important mediator involved in many cytokine induced immune and inflammatory responses. This protein has been characterized by pharmacological and molecular techniques in the mouse brain. The spindle-shaped astrocytes enclose the wound, separating the healthy from damaged neural tissue. The shape change and subsequent repair processes are IL-1β activity-dependent, acting through the IL-1 type 1 receptor (IL-1R1), as co-application of the IL-1type 1 receptor antagonist protein (IL-1ra) blocks IL-1β induced effects. In the spleen, a slight increase in IL-1R AcP and IL-1R1 was observed during the first hours following LPS stimulation. In conclusion, IL-1R AcP mRNA is expressed in the brain and in other tissues where IL-1R1/CD121a transcripts are found. However, the regulation of its expression is distinct from IL-1R1/CD121a. The high level of expression and the lack of regulation of IL-1R AcP transcripts in the brain under inflammatory conditions suggest that the protein might be constitutively expressed in excess.

References
  • Dale M, et al. (1999). "Interleukin-1 receptor cluster: gene organization of IL1R2, IL1R1, IL1RL2 (IL-1Rrp2), IL1RL1 (T1/ST2), and IL18R1 (IL-1Rrp) on human chromosome 2q.". Genomics 57 (1): 177-9.
  • Joos L, et al. (2001). "Association of IL-1beta and IL-1 receptor antagonist haplotypes with rate of decline in lung function in smokers.". Thorax 56 (11): 863-6.
  • Vigers GP, et al. (1997). "Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta.". Nature 386 (6621): 190-4.
  • Size / Price
    Catalog: RG80028-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"