IL-19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80193-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-19 Reagents
CRO Services
Product recommended

All IL-19 Reagents
IL-19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat interleukin 19 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-19 Background Information
Full Name
interleukin 19

IL-19 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IL-19 cDNA ORF Clone in Cloning Vector, Rat RG80193-G
IL-19 cDNA ORF Clone, Rat, untagged RG80193-UT
IL-19 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80193-ACGLN
IL-19 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80193-ACG
IL-19 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80193-ACR
IL-19 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80193-NF
IL-19 cDNA ORF Clone, Rat, C-His tag RG80193-CH
IL-19 cDNA ORF Clone, Rat, N-His tag RG80193-NH
IL-19 cDNA ORF Clone, Rat, C-HA tag RG80193-CY
IL-19 cDNA ORF Clone, Rat, N-HA tag RG80193-NY
IL-19 cDNA ORF Clone, Rat, C-Myc tag RG80193-CM
IL-19 cDNA ORF Clone, Rat, N-Myc tag RG80193-NM
IL-19 qPCR Primer Pairs, Rat RP300185

IL-19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL-19 cDNA ORF Clone in Cloning Vector, Mouse MG51059-G
IL-19 cDNA ORF Clone, Mouse, untagged MG51059-UT
IL-19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51059-ACG
IL-19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51059-ACGLN
IL-19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51059-ACR
IL-19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51059-CF
IL-19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51059-NF
IL-19 cDNA ORF Clone, Mouse, C-His tag MG51059-CH
IL-19 cDNA ORF Clone, Mouse, N-His tag MG51059-NH
IL-19 cDNA ORF Clone, Mouse, C-HA tag MG51059-CY
IL-19 cDNA ORF Clone, Mouse, N-HA tag MG51059-NY
IL-19 cDNA ORF Clone, Mouse, C-Myc tag MG51059-CM
IL-19 cDNA ORF Clone, Mouse, N-Myc tag MG51059-NM
info info
添加购物车成功! 添加购物车失败!