IL17B cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80170-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL17B Reagents

CRO Services

Product recommended


All IL17B Reagents

IL17B cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
543 bp
Description
Full length Clone DNA of Rat interleukin 17B with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL17B Background Information

Full Name
interleukin 17B

IL17B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IL17B cDNA ORF Clone in Cloning Vector, Rat RG80170-G
IL17B cDNA ORF Clone, Rat, untagged RG80170-UT
IL17B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80170-ACGLN
IL17B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80170-ACG
IL17B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80170-ACR
IL17B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80170-CF
IL17B cDNA ORF Clone, Rat, C-His tag RG80170-CH
IL17B cDNA ORF Clone, Rat, N-His tag RG80170-NH
IL17B cDNA ORF Clone, Rat, C-HA tag RG80170-CY
IL17B cDNA ORF Clone, Rat, N-HA tag RG80170-NY
IL17B cDNA ORF Clone, Rat, C-Myc tag RG80170-CM
IL17B cDNA ORF Clone, Rat, N-Myc tag RG80170-NM
IL17B qPCR Primer Pairs, Rat RP300163

IL17B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL17B cDNA ORF Clone in Cloning Vector, Mouse MG51304-G
IL17B cDNA ORF Clone, Mouse, untagged MG51304-UT
IL17B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51304-ACG
IL17B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51304-ACGLN
IL17B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51304-ACR
IL17B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51304-CF
IL17B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51304-NF
IL17B cDNA ORF Clone, Mouse, C-His tag MG51304-CH
IL17B cDNA ORF Clone, Mouse, N-His tag MG51304-NH
IL17B cDNA ORF Clone, Mouse, C-HA tag MG51304-CY
IL17B cDNA ORF Clone, Mouse, N-HA tag MG51304-NY
IL17B cDNA ORF Clone, Mouse, C-Myc tag MG51304-CM
IL17B cDNA ORF Clone, Mouse, N-Myc tag MG51304-NM
IL17B qPCR Primer Pairs, Mouse MP201182

IL17B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL17B cDNA ORF Clone, Human, untagged HG11939-UT
IL17B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11939-ACGLN
IL17B qPCR Primer Pairs, Human HP104691
info info
添加购物车成功! 添加购物车失败!