IL-13 cDNA ORF Clone, Rat, N-His tag

Cat: RG80460-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-13 Reagents
CRO Services
Product recommended

All IL-13 Reagents
IL-13 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
396 bp
Description
Full length Clone DNA of Rat interleukin 13 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-13 Background Information

Interleukin 13 (IL-13) is a single-chain glycosylated polypeptide, which belongs to the IL-13/IL-4 family. IL-13 protein is secreted by many cell types, but especially by T helper type 2 (Th2) cells. IL-13 exerts its effects through a multi-subunit receptor comprising the alpha chain of the IL-4 receptor (IL-4Rα) and at least one of two known IL-13-specific binding chains (IL-13 Rα1 and IL-13 Rα2). As a cytokine, IL-13 protein is critical in regulating inflammatory, immune responses and diseases. In addition, it inhibits the production of pro-inflammatory cytokines and chemokines, and thus down-regulates macrophage activity. IL-13 protein and antibody is more importantly implicated as a central mediator of immunoregulatory processes in various cell types.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 13
References
  • Junttila IS, et al. (2008) Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammac regulates relative cytokine sensitivity. J Exp Med. 205(11): 2595-608.
  • Shimamura T,et al. (2008) Novel role of IL-13 in fibrosis induced by nonalcoholic steatohepatitis and its amelioration by IL-13R-directed cytotoxin in a rat model. J Immunol. 181(7): 4656-65.
  • IL-13 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-13 cDNA ORF Clone in Cloning Vector, Rat RG80460-G
    IL-13 cDNA ORF Clone, Rat, untagged RG80460-UT
    IL-13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80460-ACG
    IL-13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80460-ACGLN
    IL-13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80460-ACR
    IL-13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80460-CF
    IL-13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80460-NF
    IL-13 cDNA ORF Clone, Rat, C-His tag RG80460-CH
    IL-13 cDNA ORF Clone, Rat, C-HA tag RG80460-CY
    IL-13 cDNA ORF Clone, Rat, N-HA tag RG80460-NY
    IL-13 cDNA ORF Clone, Rat, C-Myc tag RG80460-CM
    IL-13 cDNA ORF Clone, Rat, N-Myc tag RG80460-NM
    IL-13 qPCR Primer Pairs, Rat RP300425

    IL-13 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-13 cDNA ORF Clone in Cloning Vector, Mouse MG50225-M
    IL-13 cDNA ORF Clone, Mouse, untagged MG50225-UT
    IL-13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50225-ACG
    IL-13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50225-ACGLN
    IL-13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50225-ACR
    IL-13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50225-CF
    IL-13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50225-NF
    IL-13 cDNA ORF Clone, Mouse, C-His tag MG50225-CH
    IL-13 cDNA ORF Clone, Mouse, N-His tag MG50225-NH
    IL-13 cDNA ORF Clone, Mouse, C-HA tag MG50225-CY
    IL-13 cDNA ORF Clone, Mouse, N-HA tag MG50225-NY
    IL-13 cDNA ORF Clone, Mouse, C-Myc tag MG50225-CM
    IL-13 cDNA ORF Clone, Mouse, N-Myc tag MG50225-NM
    IL-13 qPCR Primer Pairs, Mouse MP200252

    IL-13 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-13 cDNA ORF Clone in Cloning Vector, Human HG10369-M
    IL-13 cDNA ORF Clone, Human, untagged HG10369-UT
    IL-13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10369-ACGLN
    IL-13 cDNA ORF Clone, Human, C-GFPSpark® tag HG10369-ACG
    IL-13 cDNA ORF Clone, Human, C-OFPSpark® tag HG10369-ACR
    IL-13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10369-CF
    IL-13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10369-NF
    IL-13 cDNA ORF Clone, Human, C-His tag HG10369-CH
    IL-13 cDNA ORF Clone, Human, N-His tag HG10369-NH
    IL-13 cDNA ORF Clone, Human, C-HA tag HG10369-CY
    IL-13 cDNA ORF Clone, Human, N-HA tag HG10369-NY
    IL-13 cDNA ORF Clone, Human, C-Myc tag HG10369-CM
    IL-13 cDNA ORF Clone, Human, N-Myc tag HG10369-NM
    IL-13 qPCR Primer Pairs, Human HP100404
    info info
    添加购物车成功! 添加购物车失败!