IL12B cDNA ORF Clone, Rat, N-His tag

Cat: RG80352-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL12B Reagents
CRO Services
Product recommended

All IL12B Reagents
IL12B cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Rat interleukin 12b with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL12B Background Information

Subunit beta of interleukin 12 (also known as natural killer cell stimulatory factor 2, or cytotoxic lymphocyte maturation factor 2, p40) (IL12B) is a subunit of human interleukin 12. IL12B/IL-12B is a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. IL12B/IL-12B is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. IL12B/IL-12B associates with IL23A to form the IL-23 interleukin, an heterodimeric cytokine which functions in innate and adaptive immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 12B
References
  • Taoufik Y, et al. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89 (8): 2842-8.
  • Fantuzzi L, et al. (1996) Induction of interleukin-12 (IL-12) by recombinant glycoprotein gp120 of human immunodeficiency virus type 1 in human monocytes/macrophages: requirement of gamma interferon for IL-12 secretion. J Virol. 70 (6): 4121-4.
  • Aragane Y, et al. (1995) IL-12 is expressed and released by human keratinocytes and epidermoid carcinoma cell lines. J Immunol. 153 (12): 5366-72.
  • IL12B cDNA ORF Clone, Marmoset, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Marmoset CG90289-G
    IL12B cDNA ORF Clone, Marmoset, untagged CG90289-UT
    IL12B Lentiviral cDNA ORF Clone, Marmoset, C-GFPSpark® tag CG90289-ACGLN
    IL12B cDNA ORF Clone, Marmoset, C-GFPSpark® tag CG90289-ACG
    IL12B cDNA ORF Clone, Marmoset, C-OFPSpark® tag CG90289-ACR
    IL12B cDNA ORF Clone, Marmoset, C-DDK (Flag®) tag CG90289-CF
    IL12B cDNA ORF Clone, Marmoset, N-DDK (Flag®) tag CG90289-NF
    IL12B cDNA ORF Clone, Marmoset, C-His tag CG90289-CH
    IL12B cDNA ORF Clone, Marmoset, N-His tag CG90289-NH
    IL12B cDNA ORF Clone, Marmoset, C-HA tag CG90289-CY
    IL12B cDNA ORF Clone, Marmoset, N-HA tag CG90289-NY
    IL12B cDNA ORF Clone, Marmoset, C-Myc tag CG90289-CM
    IL12B cDNA ORF Clone, Marmoset, N-Myc tag CG90289-NM

    IL12B cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Canine DG70011-M
    IL12B cDNA ORF Clone, Canine, untagged DG70011-UT
    IL12B cDNA ORF Clone, Canine, C-GFPSpark® tag DG70011-ACG
    IL12B Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70011-ACGLN
    IL12B cDNA ORF Clone, Canine, C-OFPSpark® tag DG70011-ACR
    IL12B cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70011-CF
    IL12B cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70011-NF
    IL12B cDNA ORF Clone, Canine, C-His tag DG70011-CH
    IL12B cDNA ORF Clone, Canine, N-His tag DG70011-NH
    IL12B cDNA ORF Clone, Canine, C-HA tag DG70011-CY
    IL12B cDNA ORF Clone, Canine, N-HA tag DG70011-NY
    IL12B cDNA ORF Clone, Canine, C-Myc tag DG70011-CM
    IL12B cDNA ORF Clone, Canine, N-Myc tag DG70011-NM

    IL12B cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Rhesus CG90291-G
    IL12B cDNA ORF Clone, Rhesus, untagged CG90291-UT
    IL12B cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90291-ACG
    IL12B Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90291-ACGLN
    IL12B cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90291-ACR
    IL12B cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90291-CF
    IL12B cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90291-NF
    IL12B cDNA ORF Clone, Rhesus, C-His tag CG90291-CH
    IL12B cDNA ORF Clone, Rhesus, N-His tag CG90291-NH
    IL12B cDNA ORF Clone, Rhesus, C-HA tag CG90291-CY
    IL12B cDNA ORF Clone, Rhesus, N-HA tag CG90291-NY
    IL12B cDNA ORF Clone, Rhesus, C-Myc tag CG90291-CM
    IL12B cDNA ORF Clone, Rhesus, N-Myc tag CG90291-NM

    IL12B cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Rabbit TG65008-G
    IL12B cDNA ORF Clone, Rabbit, untagged TG65008-UT
    IL12B Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65008-ACGLN
    IL12B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65008-ACG
    IL12B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65008-ACR
    IL12B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65008-CF
    IL12B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65008-NF
    IL12B cDNA ORF Clone, Rabbit, C-His tag TG65008-CH
    IL12B cDNA ORF Clone, Rabbit, N-His tag TG65008-NH
    IL12B cDNA ORF Clone, Rabbit, C-HA tag TG65008-CY
    IL12B cDNA ORF Clone, Rabbit, N-HA tag TG65008-NY
    IL12B cDNA ORF Clone, Rabbit, C-Myc tag TG65008-CM
    IL12B cDNA ORF Clone, Rabbit, N-Myc tag TG65008-NM

    IL12B cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Rat RG80352-G
    IL12B cDNA ORF Clone, Rat, untagged RG80352-UT
    IL12B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80352-ACG
    IL12B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80352-ACGLN
    IL12B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80352-ACR
    IL12B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80352-CF
    IL12B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80352-NF
    IL12B cDNA ORF Clone, Rat, C-His tag RG80352-CH
    IL12B cDNA ORF Clone, Rat, C-HA tag RG80352-CY
    IL12B cDNA ORF Clone, Rat, N-HA tag RG80352-NY
    IL12B cDNA ORF Clone, Rat, C-Myc tag RG80352-CM
    IL12B cDNA ORF Clone, Rat, N-Myc tag RG80352-NM
    IL12B qPCR Primer Pairs, Rat RP300322

    IL12B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Mouse MG51004-G
    IL12B cDNA ORF Clone, Mouse, untagged MG51004-UT
    IL12B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51004-ACGLN
    IL12B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51004-ACG
    IL12B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51004-ACR
    IL12B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51004-CF
    IL12B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51004-NF
    IL12B cDNA ORF Clone, Mouse, C-His tag MG51004-CH
    IL12B cDNA ORF Clone, Mouse, N-His tag MG51004-NH
    IL12B cDNA ORF Clone, Mouse, C-HA tag MG51004-CY
    IL12B cDNA ORF Clone, Mouse, N-HA tag MG51004-NY
    IL12B cDNA ORF Clone, Mouse, C-Myc tag MG51004-CM
    IL12B cDNA ORF Clone, Mouse, N-Myc tag MG51004-NM
    IL12B qPCR Primer Pairs, Mouse MP201172

    IL12B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL12B cDNA ORF Clone in Cloning Vector, Human HG10052-M
    IL12B cDNA ORF Clone, Human, untagged HG10052-UT
    IL12B cDNA ORF Clone, Human, C-GFPSpark® tag HG10052-ACG
    IL12B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10052-ACGLN
    IL12B cDNA ORF Clone, Human, C-OFPSpark® tag HG10052-ACR
    IL12B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10052-CF
    IL12B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10052-NF
    IL12B cDNA ORF Clone, Human, C-His tag HG10052-CH
    IL12B cDNA ORF Clone, Human, N-His tag HG10052-NH
    IL12B cDNA ORF Clone, Human, C-HA tag HG10052-CY
    IL12B cDNA ORF Clone, Human, N-HA tag HG10052-NY
    IL12B cDNA ORF Clone, Human, C-Myc tag HG10052-CM
    IL12B cDNA ORF Clone, Human, N-Myc tag HG10052-NM
    IL12B qPCR Primer Pairs, Human HP100142
    info info
    添加购物车成功! 添加购物车失败!