Quick Order

Rat IL12B/IL-12B Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat IL12B cDNA Clone Product Information
    NCBI RefSeq:NM_022611.1
    RefSeq ORF Size:1008bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 12b with C terminal His tag.
    Gene Synonym:Il12, Il12b
    Species:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL12B qPCR primers for gene expression analysis, RP300322 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Subunit beta of interleukin 12 (also known as natural killer cell stimulatory factor 2, or cytotoxic lymphocyte maturation factor 2, p40) (IL12B) is a subunit of human interleukin 12. IL12B/IL-12B is a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. IL12B/IL-12B is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. IL12B/IL-12B associates with IL23A to form the IL-23 interleukin, an heterodimeric cytokine which functions in innate and adaptive immunity.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Taoufik Y, et al. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89 (8): 2842-8.
  • Fantuzzi L, et al. (1996) Induction of interleukin-12 (IL-12) by recombinant glycoprotein gp120 of human immunodeficiency virus type 1 in human monocytes/macrophages: requirement of gamma interferon for IL-12 secretion. J Virol. 70 (6): 4121-4.
  • Aragane Y, et al. (1995) IL-12 is expressed and released by human keratinocytes and epidermoid carcinoma cell lines. J Immunol. 153 (12): 5366-72.
  • Size / Price
    Catalog: RG80352-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"