After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat Interferon beta/IFN-beta/IFNB1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat IFNB1 cDNA Clone Product Information
NCBI RefSeq:NM_019127.1
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interferon beta 1, fibroblast with C terminal Myc tag.
Gene Synonym:Ifnb, Ifnb1
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

References
  • Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.
  • Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.
  • Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.
  • Size / Price
    Catalog: RG80172-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"